901 resultados para Network anomaly detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The article seeks to investigate patterns of performance and relationships between grip strength, gait speed and self-rated health, and investigate the relationships between them, considering the variables of gender, age and family income. This was conducted in a probabilistic sample of community-dwelling elderly aged 65 and over, members of a population study on frailty. A total of 689 elderly people without cognitive deficit suggestive of dementia underwent tests of gait speed and grip strength. Comparisons between groups were based on low, medium and high speed and strength. Self-related health was assessed using a 5-point scale. The males and the younger elderly individuals scored significantly higher on grip strength and gait speed than the female and oldest did; the richest scored higher than the poorest on grip strength and gait speed; females and men aged over 80 had weaker grip strength and lower gait speed; slow gait speed and low income arose as risk factors for a worse health evaluation. Lower muscular strength affects the self-rated assessment of health because it results in a reduction in functional capacity, especially in the presence of poverty and a lack of compensatory factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The search for an Alzheimer's disease (AD) biomarker is one of the most relevant contemporary research topics due to the high prevalence and social costs of the disease. Functional connectivity (FC) of the default mode network (DMN) is a plausible candidate for such a biomarker. We evaluated 22 patients with mild AD and 26 age- and gender-matched healthy controls. All subjects underwent resting functional magnetic resonance imaging (fMRI) in a 3.0 T scanner. To identify the DMN, seed-based FC of the posterior cingulate was calculated. We also measured the sensitivity/specificity of the method, and verified a correlation with cognitive performance. We found a significant difference between patients with mild AD and controls in average z-scores: DMN, whole cortical positive (WCP) and absolute values. DMN individual values showed a sensitivity of 77.3% and specificity of 70%. DMN and WCP values were correlated to global cognition and episodic memory performance. We showed that individual measures of DMN connectivity could be considered a promising method to differentiate AD, even at an early phase, from normal aging. Further studies with larger numbers of participants, as well as validation of normal values, are needed for more definitive conclusions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mother and infant mortality has been the scope of analysis throughout the history of public health in Brazil and various strategies to tackle the issue have been proposed to date. The Ministry of Health has been working on this and the Rede Cegonha strategy is the most recent policy in this context. Given the principle of comprehensive health care and the structure of the Unified Health System in care networks, it is necessary to ensure the integration of health care practices, among which are the sanitary surveillance actions (SSA). Considering that the integration of health care practices and SSA can contribute to reduce mother and infant mortality rates, this article is a result of qualitative research that analyzed the integration of these actions in four cities in the State of São Paulo/Brazil: Campinas, Indaiatuba, Jaguariúna and Santa Bárbara D'Oeste. The research was conducted through interviews with SSA and maternal health managers, and the data were evaluated using thematic analysis. The results converge with other studies, identifying the isolation of health care practices and SSA. The insertion of SSA in collectively-managed areas appears to be a potential strategy for health planning and implementation of actions in the context under scrutiny.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To describe the clinical history of a child with aggressive behavior and recurring death-theme speech, and report the experience of the team of authors, who proposed an alternative to medication through the establishment of a protection network and the inter-sector implementation of the circle of security concept. A 5-year-old child has a violent and aggressive behavior at the day-care. The child was diagnosed by the healthcare center with depressive disorder and behavioral disorder, and was medicated with sertraline and risperidone. Side effects were observed, and the medications were discontinued. Despite several actions, such as talks, teamwork, psychological and psychiatric follow-up, the child's behavior remained unchanged. A unique therapeutic project was developed by Universidade Estadual de Campinas' Medical School students in order to establish a connection between the entities responsible for the child's care (daycare center, healthcare center, and family). Thus, the team was able to develop a basic care protection network. The implementation of the inter-sector circle of security, as well as the communication and cooperation among the teams, produced very favorable results in this case. This initiative was shown to be a feasible and effective alternative to the use of medication for this child.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The scope of this study is to identify the prevalence of access to information about how to prevent oral problems among schoolchildren in the public school network, as well as the factors associated with such access. This is a cross-sectional and analytical study conducted among 12-year-old schoolchildren in a Brazilian municipality with a large population. The examinations were performed by 24 trained dentists and calibrated with the aid of 24 recorders. Data collection occurred in 36 public schools selected from the 89 public schools of the city. Descriptive, univariate and multiple analyses were conducted. Of the 2510 schoolchildren included in the study, 2211 reported having received information about how to prevent oral problems. Access to such information was greater among those who used private dental services; and lower among those who used the service for treatment, who evaluated the service as regular or bad/awful. The latter use toothbrush only or toothbrush and tongue scrubbing as a means of oral hygiene and who reported not being satisfied with the appearance of their teeth. The conclusion drawn is that the majority of schoolchildren had access to information about how to prevent oral problems, though access was associated with the characteristics of health services, health behavior and outcomes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The experiences induced by psychedelics share a wide variety of subjective features, related to the complex changes in perception and cognition induced by this class of drugs. A remarkable increase in introspection is at the core of these altered states of consciousness. Self-oriented mental activity has been consistently linked to the Default Mode Network (DMN), a set of brain regions more active during rest than during the execution of a goal-directed task. Here we used fMRI technique to inspect the DMN during the psychedelic state induced by Ayahuasca in ten experienced subjects. Ayahuasca is a potion traditionally used by Amazonian Amerindians composed by a mixture of compounds that increase monoaminergic transmission. In particular, we examined whether Ayahuasca changes the activity and connectivity of the DMN and the connection between the DMN and the task-positive network (TPN). Ayahuasca caused a significant decrease in activity through most parts of the DMN, including its most consistent hubs: the Posterior Cingulate Cortex (PCC)/Precuneus and the medial Prefrontal Cortex (mPFC). Functional connectivity within the PCC/Precuneus decreased after Ayahuasca intake. No significant change was observed in the DMN-TPN orthogonality. Altogether, our results support the notion that the altered state of consciousness induced by Ayahuasca, like those induced by psilocybin (another serotonergic psychedelic), meditation and sleep, is linked to the modulation of the activity and the connectivity of the DMN.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plants are sessile organisms and have evolved to tolerate a constantly changing environment. After the onset of different stress conditions, calcineurin B-like (CBL) proteins can sense calcium signals and activate CBL-interacting protein kinase (CIPK) proteins, which can phosphorylate downstream proteins to reestablish plant homeostasis. Previous studies in the bioenergy crop sugarcane showed that the ScCIPK8 gene is induced by drought stress and is also related to sucrose content. Here, we have characterized the protein-protein interactions of ScCIPK8 with six CBL proteins (ScCBL1, ScCBL2, ScCBL3, ScCBL6, ScCBL9, and ScCBL10). Yeast two-hybrid assays showed that ScCIPK8 interacts with ScCBL1, ScCBL3, and ScCBL6. Bimolecular fluorescence complementation assays confirmed in planta the interactions that were observed in yeast cells. These findings give insights on the regulatory networks related to sugar accumulation and drought stress responses in sugarcane.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Interactions between flowers and their visitors span the spectrum from mutualism to antagonism. The literature is rich in studies focusing on mutualism, but nectar robbery has mostly been investigated using phytocentric approaches focused on only a few plant species. To fill this gap, we studied the interactions between a nectar-robbing hermit hummingbird, Phaethornis ruber, and the array of flowers it visits. First, based on a literature review of the interactions involving  P. ruber, we characterized the association of floral larceny to floral phenotype. We then experimentally examined the effects of nectar robbing on nectar standing crop and number of visits of the pollinators to the flowers of Canna paniculata. Finally, we asked whether the incorporation of illegitimate interactions into the analysis affects plant-hummingbird network structure. We identified 97 plant species visited by P. ruber and found that P. ruber engaged in floral larceny in almost 30 % of these species. Nectar robbery was especially common in flowers with longer corolla. In terms of the effect on C. paniculata, the depletion of nectar due to robbery by P. ruber was associated with decreased visitation rates of legitimate pollinators. At the community level, the inclusion of the illegitimate visits of P. ruber resulted in modifications of how modules within the network were organized, notably giving rise to a new module consisting of P. ruber and mostly robbed flowers. However, although illegitimate visits constituted approximately 9 % of all interactions in the network, changes in nestedness, modularity, and network-level specialization were minor. Our results indicate that although a flower robber may have a strong effect on the pollination of a particular plant species, the inclusion of its illegitimate interactions has limited capacity to change overall network structure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.