993 resultados para Microscopia Confocal


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Previous results provided evidence that Cratylia mollis seed lectin (Cramoll 1,4) promotes Trypanosoma cruzi epimastigotes death by necrosis via a mechanism involving plasma membrane permeabilization to Ca(2+) and mitochondrial dysfunction due to matrix Ca(2+) overload. In order to investigate the mechanism of Ca(2+) -induced mitochondrial impairment, experiments were performed analyzing the effects of this lectin on T. cruzi mitochondrial fraction and in isolated rat liver mitochondria (RLM), as a control. Confocal microscopy of T. cruzi whole cell revealed that Cramoll 1,4 binding to the plasma membrane glycoconjugates is followed by its internalization and binding to the mitochondrion. Electrical membrane potential (∆Ψm ) of T. cruzi mitochondrial fraction suspended in a reaction medium containing 10 μM Ca(2+) was significantly decreased by 50 μg/ml Cramoll 1,4 via a mechanism insensitive to cyclosporine A (CsA, membrane permeability transition (MPT) inhibitor), but sensitive to catalase or 125 mM glucose. In RLM suspended in a medium containing 10 μM Ca(2+) this lectin, at 50 μg/ml, induced increase in the rate of hydrogen peroxide release, mitochondrial swelling, and ∆Ψm disruption. All these mitochondrial alterations were sensitive to CsA, catalase, and EGTA. These results indicate that Cramoll 1, 4 leads to inner mitochondrial membrane permeabilization through Ca(2+) dependent mechanisms in both mitochondria. The sensitivity to CsA in RLM characterizes this lectin as a MPT inducer and the lack of CsA effect identifies a CsA-insensitive MPT in T. cruzi mitochondria.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Despite the increasing understanding of female reproduction, the molecular diagnosis of primary ovarian insufficiency (POI) is seldom obtained. The RNA-binding protein NANOS3 poses as an interesting candidate gene for POI since members of the Nanos family have an evolutionarily conserved function in germ cell development and maintenance by repressing apoptosis. We performed mutational analysis of NANOS3 in a cohort of 85 Brazilian women with familial or isolated POI, presenting with primary or secondary amenorrhea, and in ethnically-matched control women. A homozygous p.Glu120Lys mutation in NANOS3 was identified in two sisters with primary amenorrhea. The substituted amino acid is located within the second C2HC motif in the conserved zinc finger domain of NANOS3 and in silico molecular modelling suggests destabilization of protein-RNA interaction. In vitro analyses of apoptosis through flow cytometry and confocal microscopy show that NANOS3 capacity to prevent apoptosis was impaired by this mutation. The identification of an inactivating missense mutation in NANOS3 suggests a mechanism for POI involving increased primordial germ cells (PGCs) apoptosis during embryonic cell migration and highlights the importance of NANOS proteins in human ovarian biology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Surgical treatment for enterocutaneous fistulas (EF) frequently fails. Cell therapy may represent a new approach to treatment. Mesenchymal stromal cells (MSCs) have high proliferative and differentiation capacity. This study aimed to investigate whether MSCs could adhere to suture filament (SF), promoting better EF healing. MSCs, 1 × 10(6), from adipose tissue (ATMSCs) were adhered to a Polyvicryl SF by adding a specific fibrin glue formulation. Adhesion was confirmed by confocal and scanning electron microscopy (SEM). A cecal fistula was created in 22 Wistar rats by incising the cecum and suturing the opening to the surgical wound subcutaneously with four separate stitches. The animals were randomly allocated to three groups: control (CG)-five animals, EF performed; injection (IG)-eight animals 1 × 10(6) ATMSCs injected around EF borders; and suture filament (SG): nine animals, sutured with 1 × 10(6) ATMSCs attached to the filaments with fibrin glue. Fistulas were photographed on the operation day and every 3 days until the 21st day and analyzed by two observers using ImageJ Software. Confocal and SEM results demonstrated ATMSCs adhered to SF (ATMSCs-SF). The average reduction size of the fistula area at 21st day was greater for the SG group (90.34%, P < 0.05) than the IG (71.80%) and CG (46.54%) groups. ATMSCs adhered to SF maintain viability and proliferative capacity. EF submitted to ATMSCs-SF procedure showed greater recovery and healing. This approach might be a new and effective tool for EF treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neuronal ceroid-lipofuscinosis (NCL) is a recent term, proposed for acurate designation of the late-onset types of Amaurotic Family Idiocy (AFI). Histopathology shows ubiquitous intraneuronal accumulation of lipopigments, being the most important factor for characterization of the entity at present time. Biochemical changes and pathogenesis are obscure. NCL is in contrast to the infantile type of AFI (Tay-Sachs disease), in which intraneuronal accumulation of gangliosides (sphingolipids) is due to the well known deficiency of a lysosomal enzyme. The authors report on four cases of NCL, two brothers of the late infantile (Jansky-Bielschowsky) type and a brother and a sister of the juvenile (Spielmeyer-Sjögren) type. One autopsy and three cortical biopsies revealed moderate to severe distention of the neurons by lipopigment, with nerve cell loss, gliosis and cerebral atrophy. Lipopigment was also increased in liver, heart and spleen. The patients were the first in Brazilian literature in whom the storage material was identified as lipopigment by histochemical methods. A brief summary of the clinical features of NCL is presented, and relevant problems are discussed, concerning interpretation of the nature of the storage material, and significance of the disease for gerontological research.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated in vitro the capacity of debris removal from the apical third of flattened root canals, using different final irrigation protocols. Thirty human mandibular central incisors with a mesiodistal flattened root were prepared using rotary instrumentation by Endo-Flare 25.12 and Hero 642 30.06, 35.02, 40.02 files, irrigated with 2 mL of 1% NaOCl after each file. The specimens were randomly distributed into 5 groups according to the final irrigation of root canals: Group I: 10 mL of distilled water (control), Group II: 10 mL of 1% NaOCl for 8 min, Group III: 2 mL of 1% NaOCl for 2 min (repeated 4 times), Group IV: 10 mL of 2.5% NaOCl for 8 min, and Group V: 10 mL of 2.5% NaOCl for 2 min (repeated 4 times). The apical thirds of the specimens were subjected to histological processing and 6-μm cross-sections were obtained and stained with hematoxylin-eosin. The specimens were examined under optical microscopy at ×40 magnification and the images were subjected to morphometric analysis using the Scion image-analysis software. The total area of root canal and the area with debris were measured in square millimeters. Analysis of variance showed no statistically significant difference (p>0.05) among the groups GI (2.39 ± 3.59), GII (2.91 ± 2.21), GIII (0.73 ± 1.36), GIV (0.95 ± 0.84) and GV (0.51 ± 0.22). In conclusion, the final irrigation protocols evaluated in this study using the Luer syringe presented similar performance in the removal of debris from the apical third of flattened root canals.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the influence of cervical preflaring with different rotary instruments on determination of the initial apical file (IAF) in mesiobuccal roots of mandibular molars. Fifty human mandibular molars whose mesial roots presented two clearly separated apical foramens (mesiobuccal and mesiolingual) were used. After standard access opening and removal of pulp tissue, the working length (WL) was determined at 1 mm short of the root apex. Five groups (n=10) were formed at random, according to the type of instrument used for cervical preflaring. In group 1, the size of the IAF was determined without preflaring of the cervical and middle root canal thirds. In groups 2 to 5, preflaring was performed with Gates-Glidden drills, ProTaper instruments, EndoFlare instruments and LA Axxes burs, respectively. Canals were sized manually with K-files, starting with size 08 K-files, inserted passively up to the WL. File sizes were increased until a binding sensation was felt at the WL and the size of the file was recorded. The instrument corresponding to the IAF was fixed into the canal at the WL with methylcyanoacrylate. The teeth were then sectioned transversally 1 mm short of the apex, with the IAF in position. Cross-sections of the WL region were examined under scanning electron microscopy and the discrepancies between canal diameter and the diameter of IAF were calculated using the tool "rule" (FEG) of the microscope's proprietary software. The measurements (µm) were analyzed statistically by Kruskal-Wallis and Dunn's tests at 5% significance level. There were statistically significant differences among the groups (p<0.05). The non-flared group had the greatest discrepancy (125.30 ± 51.54) and differed significantly from all flared groups (p<0.05). Cervical preflaring with LA Axxess burs produced the least discrepancies (55.10 ± 48.31), followed by EndoFlare instruments (68.20 ± 42.44), Gattes Glidden drills (68.90 ± 42.46) and ProTaper files (77.40 ± 73.19). However, no significant differences (p>0.05) were found among the rotary instruments. In conclusion, cervical preflaring improved IAF fitting to the canals at the WL in mesiobuccal roots of maxillary first molars. The rotary instruments evaluated in this study did not differ from each other regarding the discrepancies produced between the IAF size and canal diameter at the WL.