Otoneurological Evaluation: Current Good Practice.

80

Beliefs And Misbeliefs About Current Interventions During Labor And Delivery In Brazil.

30 Suppl 1

Theobromine Increases Nad⁺/sirt-1 Activity And Protects The Kidney Under Diabetic Conditions.

Reduction in sirtuin 1 (Sirt-1) is associated with extracellular matrix (ECM) accumulation in the diabetic kidney. Theobromine may reduce kidney ECM accumulation in diabetic rats. In the current study, we aimed to unravel, under diabetic conditions, the mechanism of kidney ECM accumulation induced by a reduction in Sirt-1 and the effect of theobromine in these events. In vitro, we used immortalized human mesangial cells (iHMCs) exposed to high glucose (HG; 30 mM), with or without small interfering RNA for NOX4 and Sirt-1. In vivo, spontaneously hypertensive rats (SHR) were rendered diabetic by means of streptozotocin and studied after 12 wk. The effects of treatment with theobromine were investigated under both conditions. HG leads to a decrease in Sirt-1 activity and NAD(+) levels in iHMCs. Sirt-1 activity could be reestablished by treatment with NAD(+), silencing NOX4, and poly (ADP-ribose) polymerase-1 (PARP-1) blockade, or with theobromine. HG also leads to a low AMP/ATP ratio, acetylation of SMAD3, and increased collagen IV, which is prevented by theobromine. Sirt-1 or AMPK blockade abolished these effects of theobromine. In diabetic SHR, theobromine prevented increases in albuminuria and kidney collagen IV, reduced AMPK, elevated NADPH oxidase activity and PARP-1, and reduced NAD(+) levels and Sirt-1 activity. These results suggest that in diabetes mellitus, Sirt-1 activity is reduced by PARP-1 activation and NAD(+) depletion due to low AMPK, which increases NOX4 expression, leading to ECM accumulation mediated by transforming growth factor (TGF)-β1 signaling. It is suggested that Sirt-1 activation by theobromine may have therapeutic potential for diabetic nephropathy.

Preparative separation of flavonoids from the medicinal plant Davilla elliptica St. Hill. by high-speed counter-current chromatography

High-speed counter-current chromatography (HSCCC) is a major tool for the fast separation of natural products from plants. It was used for the preparative isolation of the flavonoid monoglucosides present in the aerial parts of the Davilla elliptica St. Hill. (Dilleniaceae). This species is used in Brazilian folk medicine for the treatment of gastric disorders. The optimum solvent system used was composed of a mixture of ethyl acetate-n-propanol-water (140:8:80, v/v/v) and led to a successful separation of quercetin-3-O-alpha-L-rhamnopyranoside and myricetin-3-O-alpha-L-rhamnopyranoside in approximately 3.0 hours with purity higher than 95%. Identification was performed by ¹H NMR, 13C NMR and HPLC-UV-DAD analyses.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Handebol em cadeira de rodas : diretrizes para a classificação

Universidade Estadual de Campinas. Faculdade de Educação Física

Juventude, lazer e uso abusivo de alcool

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol para cegos (futebol de cinco) no Brasil : leitura do jogo e estrategias tatico-tecnicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Sistema de periodização em blocos : efeitos de um modelo de treinamento sobre o desempenho de nadadores velocistas de alto nivel

Universidade Estadual de Campinas . Faculdade de Educação Física

A estrutura esportiva no Estado do Parana : da formação dos clubes esportivos

Universidade Estadual de Campinas . Faculdade de Educação Física

Os donos das pistas : uma efigie sociologica do esporte federativo brasileiro

Universidade Estadual de Campinas . Faculdade de Educação Física

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

T-wave alternans: desempenho clínico, limitações, metodologias de análise

Reconhecer com precisão indivíduos com maior risco imediato de morte súbita cardíaca (MSC) ainda é uma questão em aberto. A natureza fortuita dos eventos cardiovasculares agudos não parece se adequar ao conhecido modelo de indução de taquicardia/fibrilação ventricular por um gatilho em sincronia a um substrato arritmogênico estático. Quanto ao mecanismo da MSC, uma instabilidade elétrica dinâmica explicaria melhor a raridade da associação simultânea de um gatilho certo a um substrato cardíaco apropriado. Diversos estudos tentaram medir essa instabilidade elétrica cardíaca (ou um equivalente válido) em uma sequência de batimentos cardíacos no ECG. Dentre os mecanismos possíveis podemos citar o prolongamento do QT, dispersão do QT, potenciais tardios, alternância de onda T ou T-wave alternans (TWA), e turbulência da frequência cardíaca. Este artigo se atém em particular ao papel da TWA no panorama atual da estratificação de risco cardíaco. Os achados sobre TWA ainda são heterogêneos, variando de um desempenho prognóstico muito bom até um quase nulo, dependendo da população clínica observada e protocolo clínico usado. Para preencher as atuais lacunas no conhecimento sobre TWA, profissionais médicos e pesquisadores devem explorar melhor as características técnicas das diversas tecnologias disponíveis para a avaliação de TWA e atentar ao fato de que os valores de TWA respondem a diversos outros fatores, além de medicamentos. Informações sobre mecanismos celulares e subcelulares da TWA estão fora do escopo deste artigo, mas são referenciados alguns dos principais trabalhos sobre este tópico, com o intuito de auxiliar no entendimento dos conceitos e fatos cobertos neste artigo.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.