A comparative assessment of potential components of partial disease resistance to Fusarium head blight detected in a detached leaf assay of wheat, barley and oats.

The relative resistance of 15 winter barley, three winter wheat and three winter oat cultivars on the UK recommended list 2003 and two spring wheat cultivars on the Irish 2003 recommended list were evaluated using Microdochium nivale in detached leaf assays to further understand components of partial disease resistance (PDR) and Fusarium head blight (FHB) resistance across cereal species. Barley cultivars showed incubation periods comparable to, and latent periods longer than the most FHB resistant Irish and UK wheat cultivars evaluated. In addition, lesions on barley differed from those on wheat as they were not visibly chlorotic when placed over a light box until sporulation occurred, in contrast to wheat cultivars where chlorosis of the infected area occurred when lesions first developed. The pattern of delayed chlorosis of the infected leaf tissue and longer latent periods indicate that resistances are expressed in barley after the incubation period is observed, and that these temporarily arrest the development of mycelium and sporulation. Incubation periods were longer for oats compared to barley or wheat cultivars. However, oat cultivars differed from both wheat and barley in that mycelial growth was observed before obvious tissue damage was detected under macroscopic examination, indicating tolerance of infection rather than inhibition of pathogen development, and morphology of sporodochia differed, appearing less well developed and being much less abundant. Longer latent periods have previously been related to greater FHB resistance in wheat. The present results suggest the longer latent periods of barley and oat cultivars, than wheat, are likely to play a role in overall FHB resistance if under the same genetic control as PDR components expressed in the head. However the limited range of incubation and latent periods observed within barley and oat cultivars evaluated was in contrast with wheat where incubation and latent periods were shorter and more variable among genotypes. The significance of the various combinations of PDR components detected in the detached leaf assay as components of FHB resistance in each crop requires further investigation, particularly with regard to the apparent tolerance of infection in oats and necrosis in barley, after the incubation period is observed, associated with retardation of mycelial growth and sporulation.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The inactivation of bovine cathepsin B by novel N-chloro-acetyl-dipeptides. Application of the Houghten 'tea bag' methodology to inhibitor synthesis

In this study, a series of N-chloro-acetylated dipeptides were synthesised by the application of Houghten's methodology of multiple analog peptide syntheses. The peptides, all of which contain a C-terminal free acid, were tested as inactivators of bovine cathepsin B, in an attempt at exploiting the known and, amongst the cysteine proteinases, unique carboxy dipeptidyl peptidase activity of the protease. We have succeeded in obtaining a number of effective inactivators, the most potent of which-chloroacetyl-Leu-Leu-OH, inactivates the enzyme with an apparent second-order rate constant of 3.8 x 10(4) M-1 min(-1). In contrast, the esterified analog, chloroacetyl-Leu-Leu-OMe, inactivates the enzyme some three orders of magnitude less efficiently, lending credence to our thesis that a free carboxylic acid moiety is an important determinant for inhibitor effectiveness. This preliminary study has highlighted a number of interesting features about the specificity requirements of the bovine proteinase and we believe that our approach has great potential for the rapid delineation of the subsite specificities of cathepsin B-like proteases from various species. (c) 2005 Elsevier Inc. All rights reserved.

Escape times for rigid Brownian rotators in a bistable potential from the time evolution of the Green function and the characteristic time of the probability evolution

The greatest relaxation time for an assembly of three- dimensional rigid rotators in an axially symmetric bistable potential is obtained exactly in terms of continued fractions as a sum of the zero frequency decay functions (averages of the Legendre polynomials) of the system. This is accomplished by studying the entire time evolution of the Green function (transition probability) by expanding the time dependent distribution as a Fourier series and proceeding to the zero frequency limit of the Laplace transform of that distribution. The procedure is entirely analogous to the calculation of the characteristic time of the probability evolution (the integral of the configuration space probability density function with respect to the position co-ordinate) for a particle undergoing translational diffusion in a potential; a concept originally used by Malakhov and Pankratov (Physica A 229 (1996) 109). This procedure allowed them to obtain exact solutions of the Kramers one-dimensional translational escape rate problem for piecewise parabolic potentials. The solution was accomplished by posing the problem in terms of the appropriate Sturm-Liouville equation which could be solved in terms of the parabolic cylinder functions. The method (as applied to rotational problems and posed in terms of recurrence relations for the decay functions, i.e., the Brinkman approach c.f. Blomberg, Physica A 86 (1977) 49, as opposed to the Sturm-Liouville one) demonstrates clearly that the greatest relaxation time unlike the integral relaxation time which is governed by a single decay function (albeit coupled to all the others in non-linear fashion via the underlying recurrence relation) is governed by a sum of decay functions. The method is easily generalized to multidimensional state spaces by matrix continued fraction methods allowing one to treat non-axially symmetric potentials, where the distribution function is governed by two state variables. (C) 2001 Elsevier Science B.V. All rights reserved.

Chemical abundances and winds of massive stars in M31: a B-type supergiant and a WC star in OB 10

We present high quality spectroscopic data for two massive stars in the OB 10 association of M31, OB 10-64 (B0 la) and OB 10-WRI (WC6). Medium resolution spectra of both stars were obtained using the ISIS spectrograph on the William Herschel Telescope. This is supplemented with Hubble Space Telescope STIS UV spectroscopy and Keck I HIRES data for OB 10-64. A non- local thermodynamic equilibrium (LTE) model atmosphere and abundance analysis for OB 10-64 is presented, indicating that this star has similar photospheric CNO, Mg and Si abundances to solar neighbourhood massive stars. A wind analysis of this early B-type supergiant reveals a mass-loss rate of (M)over dot = 1.6 x 10(-6) M-circle dot yr(-1), and v(infinity) = 1650 km s(-1). The corresponding wind momentum is in good agreement with the wind momentum-luminosity relationship found for Galactic early-B supergiants. Observations of OB 10-WRI are analysed using a non-LTE, line-blanketed code, to reveal approximate stellar parameters of log L/L-circle dot similar to 5.7, T-* - 75 kK, v(infinity) similar to 3000 km s(-1), (M)over dot/(M-circle dot yr(-1)) similar to 10(-4.3) adopting a clumped wind with a filling factor of 10 per cent. Quantitative comparisons are made with the Galactic WC6 star HD 92809 (WR23) revealing that OB 10-WR1 is 0.4 dex more luminous, though it has a much lower C/He ratio (similar to0.1 versus 0.3 for HD 92809). Our study represents the first detailed, chemical model atmosphere analysis for either a B-type supergiant or a Wolf- Rayet (WR) star in Andromeda, and shows the potential of how such studies can provide new information on the chemical evolution of galaxies and the evolution of massive stars in the local Universe.

Element partitioning and potential mobility within surface dusts on buildings in a polluted urban environment, Budapest.

A voluminous literature exists on the analysis of water-soluble ions extracted from gypsum crusts and patinas formed on building surfaces. However, less data is available on the intermediate dust layer and the important role its complex matrix and constituents play in crust/patina formation. To address this issue, surface dust samples were collected from two buildings in the city of Budapest. Substrate properties, different pollution levels and environmental variations were considered by collecting samples from a city centre granite building exposed to intense traffic conditions and from an oolitic limestone church situated in a pedestrian area outside and high above the main pollution zone. Selective extraction examines both water-soluble ions (Ca2+, Mg2+, Na+, K+, Cl-, NO3- SO42-) and selected elements (Fe, Mn, Zn, Cu, Cr, Pb, Ni) from the water-soluble, exchangeable/carbonate, amorphous Mn, amorphous Fe/Mn, crystalline Fe/Mn, organic and residual phases, their mobility and potential to catalyse heterogeneous surface reactions. Salt weathering processes are highlighted by high concentrations of water-soluble Ca2+, Na+, Cl- and SO42-- at both sites. Manganese, Zn and Cu and to a lesser extent Pb and Ni, are very mobile in the city centre dust, where 30%, 54%, 38%, 11% and 11% of their totals are bound by the water-soluble phase, respectively. Church dust shows a sharp contrast for Mn, Zn, Cu and Pb with only 3%, 1%, 12% and 3% of their totals being bound by the water-soluble phase respectively. This may be due to (a) different environmental conditions at the church e.g. lower humidity (b) continuous replenishment of salts under intensive city centre traffic conditions (c) enrichment in oxidisable organic carbon by a factor of 4.5 and a tenfold increase in acidity in the city centre dust.

Potential improvements in the therapeutic ratio of prostate cancer irradiation: dose escalation of pathologically identified tumour nodules using intensity modulated radiotherapy.

The potential of intensity modulated radiotherapy (IMRT) to improve the therapeutic ratio in prostate cancer by dose escalation of intraprostatic tumour nodules (IPTNs) was investigated using a simultaneous integrated boost technique. The prostate and organs-at-risk were outlined on CT images from six prostate cancer patients. Positions of IPTNs were transferred onto the CT images from prostate maps derived from sequential large block sections of whole prostatectomy specimens. Inverse planned IMRT dose distributions were created to irradiate the prostate to 70 Gy and all the IPTNs to 90 Gy. A second plan was produced to escalate only the dominant IPTN (DIPTN) to 90 Gy, mimicking current imaging techniques. These plans were compared with homogeneous prostate irradiation to 70 Gy using dose–volume histograms, tumour control probability (TCP) and normal tissue complication probability (NTCP) for the rectum. The mean dose to IPTNs was increased from 69.8 Gy to 89.1 Gy if all the IPTNs were dose escalated (p=0.0003). This corresponded to a mean increase in TCP of 8.7–31.2% depending on the /ß ratio of prostate cancer (p