932 resultados para Social event detection
Resumo:
one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
This paper analyses some aspects of the trajectory of the Argentinian physician and sociologist Juan César García (1932-1984) in the field of Latin American Social Medicine. Three dimensions constituting his basic orientations are highlighted: the elaboration of systematic and reflective social thought; a critical attitude in questioning teaching and professional practices; a commitment to the institutionalization and dissemination of health knowledge.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
Mental health problems are common in primary health care, particularly anxiety and depression. This study aims to estimate the prevalence of common mental disorders and their associations with socio-demographic characteristics in primary care in Brazil (Family Health Strategy). It involved a multicenter cross-sectional study with patients from Rio de Janeiro, São Paulo, Fortaleza (Ceará State) and Porto Alegre (Rio Grande do Sul State), assessed using the General Health Questionnaire (GHQ-12) and the Hospital Anxiety and Depression Scale (HAD). The rate of mental disorders in patients from Rio de Janeiro, São Paulo, Fortaleza and Porto Alegre were found to be, respectively, 51.9%, 53.3%, 64.3% and 57.7% with significant differences between Porto Alegre and Fortaleza compared to Rio de Janeiro after adjusting for confounders. Prevalence proportions of mental problems were especially common for females, the unemployed, those with less education and those with lower incomes. In the context of the Brazilian government's moves towards developing primary health care and reorganizing mental health policies it is relevant to consider common mental disorders as a priority alongside other chronic health conditions.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física