Discriminação alélica do fator V da coagulação por PCR em tempo real: diagnóstico simples e preciso

Dentre as doenças cardiovasculares, a trombose venosa (TV) destaca-se pela associação entre fatores de riscos adquiridos e fatores genéticos. A resistência hereditária à proteína C ativada tem sido identificada como a principal causa dos casos de trombose venosa, sendo frequentemente associada à mutação fator V Leiden (G1694A). Em indivíduos homozigotos, o risco de trombose venosa é 50 a 100 vezes maior que em pacientes homozigotos normais, enquanto em pacientes heterozigotos o risco é de 5 a 10 vezes. Baseado na necessidade de avaliação e acompanhamento de pacientes com casos de trombose venosa e prevenção de seus respectivos familiares, foi desenvolvido um método simples de discriminação alélica do fator V da coagulação utilizando PCR em tempo real. Foram selecionados 67 pacientes com histórico de TV e 51 indivíduos sem histórico de TV. Primeiramente, a discriminação alélica do fator V foi realizada através de PCR convencional seguida de digestão enzimática (Mnl). Posteriormente, o diagnóstico foi realizado por PCR em tempo real. Ambos os métodos foram baseados no polimorfismo G1691A, sendo no segundo utilizado fluoróforos VIC e FAM para marcar os nucleotídeos G e A, respectivamente. A técnica de PCR-RFLP foi utilizada para diagnosticar 95 indivíduos homozigotos normais, 21 heterozigotos e 2 homozigotos FVL. Utilizando PCR em tempo real foram obtidos os mesmos resultados. A máxima similaridade entre os resultados obtidos por PCR em tempo real e PCR-RFLP indicou precisão significativa do novo método de discriminação e visualização alélica do fator V.

Identificação do sexo de embriões humanos através da análise de blastômero pelas técnicas da reação em cadeia da polimerase em tempo real (PCR em tempo real) e hibridização in situ fluorescente (FISH)

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Nested-PCR do gene que codifica o antígeno b aplicada ao diagnóstico da tuberculose pulmonar

A reação em cadeia da polimerase usada para amplificação de uma seqüência interna de um fragmento previamente amplificado (nested-PCR) foi investigada como uma alternativa complementar a pesquisa de bacilos álcool ácido resistentes e a cultura do Mycobacterium tuberculosis em meio de Lowenstein-Jensen. Foram investigadas 144 amostras de escarro de pacientes suspeitos de tuberculose encaminhados ao Laboratório de Tuberculose do Instituto Evandro Chagas em Belém, no período de junho de 2002 a dezembro de 2003. Das 144 amostras, 121 foram caracterizadas como tuberculose, 119 foram positivas na cultura, 95 na baciloscopia e 128 na nested-PCR. A sensibilidade da nested-PCR foi 96% (116/121), enquanto a especificidade foi 48% (11/23). A nested-PCR poderá ser uma ferramenta complementar para o diagnóstico da tuberculose, pois apresenta sensibilidade equivalente à cultura, no entanto, necessita de maiores avaliações visando minimizar o número de resultados falso-positivos.

Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR

Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Multiplex-PCR for differentiation of Mycobacterium bovis from Mycobacterium tuberculosis complex

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

The detection of Cryptosporidium serpentis in snake fecal samples by real-time PCR

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Caracterização das espécies de leishmania em sangue periférico de cães por PCR-RFLP NA área endêmica de Bauru/SP

Pós-graduação em Ciência Animal - FMVA

Differentiation of Haemonchus placei from Haemonchus contortus by PCR and by morphometrics of adult parasites and third stage larvae

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Taenia saginata: polymerase chain reaction for taeniasis diagnosis in human fecal samples

The taeniasis-cysticercosis complex is a zoonosis of great medical and economic importance where humans play an important role as the carrier of adult stage of Taenia solium and Taenia saginata. This paper describes PCR standardization that can be applied in human fecal samples for taeniasis diagnosis. DNA extraction was achieved with DNAzol reagent, after egg disruption with glass beads. DNA prepared from fecal specimens was first purified and PCR amplified generating fragments of 170 and 600 bp. The assay described herein provides an important tool for T. saginata identification in human fecal samples.

Hemoculture and polymerase chain reaction using primers TCZ1/TCZ2 for the diagnosis of canine and feline trypanosomiasis

Introduction. American trypanosomiasis, also known as Chagas disease, is a zoonosis caused by Trypanosoma cruzi (T. cruzi). Dogs and cats participate actively in this parasite's transmission cycle. This study aimed at evaluating the occurrence of T. cruzi in dogs and cats from Botucatu, SP, Brazil, as well as at evaluating the technique of hemoculture in LIT (liver infusion tryptose) medium by polymerase chain reaction (PCR). Methods. Blood samples were collected from 50 dogs and 50 cats in Botucatu-SP, Brazil. For hemoculture, the samples were inoculated in LIT medium, and readings were performed for four months. Upon completion of such period, all the hemocultures were processed for parasitic DNA extraction. The PCR reactions were performed by using primers TCZ1/TCZ2. Results. Ten dogs and ten cats (20%) were positive to PCR, and four dogs and three cats (7%) were positive to hemoculture. Only in a one cat sample (1%) there was confirmation of positive hemoculture by PCR for T. cruzi. Conclusions. Results showed that PCR was a suitable tool for the confirmation of the parasite detection in hemoculture samples, and that dogs and cats from Botucatu, SP, Brazil, are maintaining the role of household reservoirs of T. cruzi, which reinforces the need for constant epidemiologic surveillance for this zoonosis.

Detection of Trypanosoma vivax using PCR and LAMP during aparasitemic periods

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.