39 resultados para silencer


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Decapentaplegic (Dpp), the fly homolog of the secreted mammalian BMP2/4 signaling molecules, is involved in almost all aspects of fly development. Dpp has critical functions at all developmental stages, from patterning of the eggshell to the determination of adult intestinal stem cell identity. Here, we focus on recent findings regarding the transcriptional regulatory logic of the pathway, on a new feedback regulator, Pentagone, and on Dpp's roles in scaling and growth of the Drosophila wing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The neuronal-specific protein complexin I (CPX I) plays an important role in controlling the Ca(2+)-dependent neurotransmitter release. Since insulin exocytosis and neurotransmitter release rely on similar molecular mechanisms and that pancreatic beta-cells and neuronal cells share the expression of many restricted genes, we investigated the potential role of CPX I in insulin-secreting cells. We found that pancreatic islets and several insulin-secreting cell lines express high levels of CPX I. The beta-cell expression of CPX I is mediated by the presence of a neuron restrictive silencer element located within the regulatory region of the gene. This element bound the transcriptional repressor REST, which is found in most cell types with the exception of mature neuronal cells and beta-cells. Overexpression of CPX I or silencing of the CPX I gene (Cplx1) by RNA interference led to strong impairment in beta-cell secretion in response to nutrients such as glucose, leucine and KCl. This effect was detected both in the early and the sustained secretory phases but was much more pronounced in the early phase. We conclude that CPX I plays a critical role in beta-cells in the control of the stimulated-exocytosis of insulin.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

How immature CD4+CD8+ thymocytes become committed to either the CD4 (helper) or CD8 (cytotoxic) lineage is controversial. Genetic ablation of a silencer element in the gene encoding CD4 provides new evidence that CD8 lineage commitment occurs via a stochastic, rather than instructive, mechanism.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The control of CD4 gene expression is essential for proper T lymphocyte development. Signals transmitted from the T-cell antigen receptor (TCR) during the thymic selection processes are believed to be linked to the regulation of CD4 gene expression during specific stages of T cell development. Thus, a study of the factors that control CD4 gene expression may lead to further insight into the molecular mechanisms that drive thymic selection. In this review, we discuss the work conducted to date to identify and characterize the cis-acting transcriptional control elements in the CD4 locus and the DNA-binding factors that mediate their function. From these studies, it is becoming clear that the molecular mechanisms controlling CD4 gene expression are very complex and differ at each stage of development. Thus, the control of CD4 expression is subject to many different influences as the thymocyte develops.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We report here for the first time the structure and function of a promoter from a cestode. The ability of DNA fragments respectively encompassing the 935-bp and 524-bp regions upstream from the ATG codon from the EgactI and EgactII actin genes of Echinococcus granulosus to promote transcription was studied in the NIH3T3 mouse cell line. The results of transfection assays showed that both regions have strong promoter activity in these cells. The fragments were tested in both orientations and the 524-bp fragment of EgactII presented a bidirectional promoter activity. Deletion analysis of EgactI and EgactII promoters indicated the presence of regulatory regions containing putative silencer elements. These results indicate that both EgactI and EgactII promoters are functional and that the preliminary functional evaluation of E. granulosus and possibly of other cestode promoters can be performed in heterologous cell lines.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Arabidopsis is a model plant used to study disease resistance; Solanum tuberosum or potato is a crop species. Both plants possess inducible defense mechanisms that are deployed upon recognition of pathogen invasion. Transcriptional reprogramming is crucial to the activation of defense responses. The Pathogenesis-Related (PR) genes are activated in these defense programs. Expression of Arabidopsis PR-l and potato PR-10a serve as markers for the deployment of defense responses in these plants. PR-l expression indicates induction of systemic acquired resistance (SAR). Activation of SAR requires accumulation of salicylic acid (SA), in addition to the interaction of the non-expressor of pathogenesis-related genes I (NPRI), with the TGA transcription factors. The PR-10a is activated in response to pathogen invasion, wounding and elicitor treatment. PR-10a induction requires recruitment of the Whirly I (Whyl) activator to the promoter. This locus is also negatively regulated by the silencer element binding factor (SEBF). We established that both the PR-l and PR-10a are occupied by repressors under non-inducing conditions. TGA2 was found to be a constitutive resident and repressor of PR-l, which mediates repression by forming an oligomeric complex on the promoter. The DNA-binding activity of this oligomer required the TGA2 N-terminus (NT). Under resting conditions we determined that the PR-10a is bound by a repressosome containing SEBF and curiously the activator Pto interacting protein 4 (Pti4). In the context of this repressosome, SEBF is responsible for PR-10a binding, yet rWe also showed that PR-l and PR-10a are activated by different means. In PR-l activation the NPRI NT domain alleviates TGA2-mediated repression by interacting with the TGA2 NT. TGA2 remains at the PR-l but adopts a dimeric conformation and forms an enhanceosome with NPRl. In contrast, the PR-10a is activated by evicting the repressosome and recruiting Why! to the promoter. These results advance our understanding of the mechanisms regulating PR-l and PR-10a expression under resting and inducing conditions. This study also revealed that the means of regulation for related genes can differ greatly between model and crop s

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Le cancer est la principale cause de mortalité au Canada. Les taxanes (e.g. le paclitaxel et le docétaxel (DCTX)) constituent des remèdes efficaces contre une série de tumeurs solides telles que les cancers du sein, du poumon et de l’ovaire. Par ailleurs, des acides nucléiques (e.g. les oligonucléotides antisens (AON) ou les petits ARN interférents (siRNAs)), capables de supprimer sélectivement certains oncogènes impliqués dans la carcinogénèse, sont actuellement étudiés pour traiter une large gamme de cancers. Bien que l’activité des taxanes et des acides nucléiques soit bien établie sur des modèles humains et/ou animaux, plusieurs aspects physico-chimiques et cliniques restent encore à améliorer. Leur solubilité limitée (pour les taxanes), leur dégradation rapide dans le sang (pour les acides nucléiques), leur élimination précoce, leur absence de sélectivité et leur toxicité envers les tissus sains sont les principaux facteurs limitant leur efficacité. C’est pourquoi de nombreux efforts ont porté sur l’élaboration de systèmes de vectorisation ciblés à base de polymères, dans le but de surmonter les problèmes associés aux thérapies actuelles. Dans cette thèse, deux types de micelles polymères ont été développés pour la vectorisation de DCTX et d’acides nucléiques. D’une part, des micelles de poly(oxyde d’éthylène)-bloc-poly(oxyde de butylène/styrène) ont été étudiées pour la première fois pour solubiliser le DCTX et le protéger de l’hydrolyse. Ces polymères se sont révélés moins toxiques que le surfactant utilisé commercialement pour solubiliser le DCTX (i.e. polysorbate 80) et ont permis une libération prolongée du principe actif. D’autre part, deux systèmes différents de micelles polyioniques (PICM) ont été mis au point pour la vectorisation d’acides nucléiques. De nouveaux conjugués de poly(éthylène glycol) (PEG)-oligonucléotide ont été proposés pour la protection et la libération contrôlée d’AON. Lorsque ces conjugués ont été formulés avec des dendrimères de poly(amidoamine) (PAMAM), des complexes de taille homogène ont été obtenus. Ces PICM ont permis de prolonger la libération de l’AON et de le protéger efficacement contre la dégradation enzymatique. De plus, des polymères de poly(oxyde d’éthylène)-bloc-poly(méthacrylate de propyle-co-acide méthacrylique) ont été incorporés afin de conférer des propriétés acido-sensibles aux PICM. Dans ces micelles, formées de ce dernier polymère formulé avec le dendrimère PAMAM, des oligonucléotides (AON et siRNA) ciblant l’oncogène Bcl-2 ont été encapsulés. L’internalisation cellulaire fut assurée par un fragment d’anticorps monoclonal (Fab’) situé à l’extrémité de la couronne de PEG. Après l’internalisation cellulaire et la protonation des unités d’acide méthacrylique sous l’effet de l’acidification des endosomes, les micelles se sont affranchies de leur couronne. Elles ont ainsi exposé leur cœur composé d’acide nucléique et de dendrimère PAMAM, qui possède une charge positive et des propriétés endosomolytiques. En effet, ces PICM acido-sensibles ciblées ont permis d’augmenter la biodisponibilité des acides nucléiques vectorisés et se sont avérées plus efficaces pour silencer l’oncoprotéine Bcl-2 que les micelles non ciblées ou que le dendrimère de PAMAM commercial seul. Finalement, les nanovecteurs polymères présentés dans cette thèse se révèlent être des systèmes prometteurs pour la vectorisation des anticancéreux et des acides nucléiques.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pós-graduação em Agronomia (Energia na Agricultura) - FCA

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Im Rahmen der vorliegenden Dissertation wurden Untersuchungen zur Expression und Funktion der respiratorischen Proteine Neuroglobin (Ngb) und Cytoglobin (Cygb) in Vertebraten durchgeführt. Beide Globine wurden erst kürzlich entdeckt, und ihre Funktionen konnten trotz vorliegender Daten zur Struktur und biochemischen Eigenschaften dieser Proteine bisher nicht eindeutig geklärt werden. Im ersten Abschnitt der vorliegenden Arbeit wurde die zelluläre und subzelluläre Lokalisation von Neuroglobin und Cytoglobin in murinen Gewebeschnitten untersucht. Die Expression von Ngb in neuronalen und endokrinen Geweben hängt offensichtlich mit den hohen metabolischen Aktivitäten dieser Organe zusammen. Insbesondere im Gehirn konnten regionale Unterschiede in der Ngb-Expression beobachtet werden. Dabei korrelierte eine besonders starke Neuroglobin-Expression mit Gehirnbereichen, die bekanntermaßen die höchsten Grundaktivitäten aufweisen. In Anbetracht dessen liegt die Funktion des Neuroglobins möglicherweise im basalen O2-Metabolismus dieser Gewebe, wobei Ngb als O2-Lieferant und kurzfristiger O2-Speicher den vergleichsweise hohen Sauerstoffbedarf vor Ort sicherstellen könnte. Weitere Funktionen in der Entgiftung von ROS bzw. RNS oder die kürzlich publizierte mögliche Rolle des Ngb bei der Verhinderung der Mitochondrien-vermittelten Apoptose durch eine Reduktion des freigesetzten Cytochrom c wären darüber hinaus denkbar. Die Cygb-Expression im Gehirn beschränkte sich auf relativ wenige Neurone in verschiedenen Gehirnbereichen und zeigte dort vorwiegend eine Co-Lokalisation mit der neuronalen NO-Synthase. Dieser Befund legt eine Funktion des Cytoglobins im NO-Metabolismus nahe. Quantitative RT-PCR-Experimente zur mRNA-Expression von Ngb und Cygb in alternden Säugern am Bsp. der Hamsterspezies Phodopus sungorus zeigten keine signifikanten Änderungen der mRNA-Mengen beider Globine in alten im Vergleich zu jungen Tieren. Dies widerspricht publizierten Daten, in denen bei der Maus anhand von Western Blot-Analysen eine Abnahme der Neuroglobin-Menge im Alter gezeigt wurde. Möglicherweise handelt es sich hierbei um speziesspezifische Differenzen. Die im Rahmen dieser Arbeit durchgeführte vergleichende Sequenzanalyse der humanen und murinen NGB/Ngb-Genregion liefert zum einen Hinweise auf die mögliche Regulation der Ngb-Expression und zum anderen eine wichtige Grundlage für die funktionellen Analysen dieses Gens. Es konnte ein minimaler Promotorbereich definiert werden, der zusammen mit einigen konservierten regulatorischen Elementen als Basis für experimentelle Untersuchungen der Promotoraktivität in Abhängigkeit von äußeren Einflüssen dienen wird. Bioinformatische Analysen führten zur Identifizierung des sog. „neuron restrictive silencer element“ (NRSE) im Ngb-Promotor, welches vermutlich für die vorwiegend neuronale Expression des Proteins verantwortlich ist. Die kontrovers diskutierte O2-abhängige Regulation der Ngb-Expression konnte hingegen anhand der durchgeführten komparativen Sequenzanalysen nicht bestätigt werden. Es wurden keine zwischen Mensch und Maus konservierten Bindestellen für den Transkriptionsfaktor HIF-1 identifiziert, der die Expression zahlreicher hypoxieregulierter Gene, z.B. Epo und VEGF, vermittelt. Zusammen mit den in vivo-Daten spricht dies eher gegen eine Regulation der Ngb-Expression bei verminderter Verfügbarkeit von Sauerstoff. Die Komplexität der Funktionen von Ngb und Cygb im O2-Stoffwechsel der Vertebraten macht den Einsatz muriner Modellsysteme unerlässlich, die eine sukzessive Aufklärung der Funktionen beider Proteine erlauben. Die vorliegende Arbeit liefert auch dazu einen wichtigen Beitrag. Die hergestellten „gene-targeting“-Vektorkonstrukte liefern in Verbindung mit den etablierten Nachweisverfahren zur Genotypisierung von embryonalen Stammzellen die Grundlage zur erfolgreichen Generierung von Ngb-knock out sowie Ngb- und Cygb-überexprimierenden transgenen Tieren. Diese werden für die endgültige Entschlüsselung funktionell relevanter Fragestellungen von enormer Bedeutung sein.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Repressor element 1 (RE1)-silencing transcription factor (REST)/neuron-restrictive silencer factor (NRSF) can repress several terminal neuronal differentiation genes by binding to a specific DNA sequence (RE1/neuron-restrictive silencer element [NRSE]) present in their regulatory regions. REST-VP16 binds to the same RE1/NRSE, but activates these REST/NRSF target genes. However, it is unclear whether REST-VP16 expression is sufficient to cause formation of functional neurons either from neural stem cells or from heterologous stem cells. Here we show that the expression of REST-VP16 in myoblasts grown under muscle differentiation conditions blocked entry into the muscle differentiation pathway, countered endogenous REST/NRSF-dependent repression, activated the REST/NRSF target genes, and, surprisingly, activated other neuronal differentiation genes and converted the myoblasts to a physiologically active neuronal phenotype. Furthermore, in vitro differentiated neurons produced by REST-VP16-expressing myoblasts, when injected into mouse brain, survived, incorporated into the normal brain, and did not form tumors. This is the first instance in which myoblasts were converted to a neuronal phenotype. Our results suggest that direct activation of REST/NRSF target genes with a single transgene, REST-VP16, is sufficient to activate other terminal neuronal differentiation genes and to override the muscle differentiation pathways, and they suggest that this approach provides an efficient way of triggering neuronal differentiation in myoblasts and possibly other stem cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Wilms' tumor gene, WT1, encodes a zinc finger transcription factor which functions as a tumor suppressor. Defects in the WT1 gene can result in the development of nephroblastoma. WT1 is expressed during development, primarily in the metanephric kidney, the mesothelial lining of the abdomen and thorax, and the developing gonads. WT1 expression is tightly regulated and is essential for renal development. The WT1 gene encodes a protein with a proline-rich N-terminus which functions as a transcriptional repressor and C-terminus contains 4 zinc fingers that mediate DNA binding. WT1 represses transcription from a number of growth factors and growth factor receptors. WT1 mRNA undergoes alternative splicing at two sites, resulting in 4 mRNA species and polypeptide products. Exon 5, encoding 17 amino acids is alternatively spliced, and is located between the transcriptional repression domain and the DNA binding domain. The second alternative splice is the terminal 9 nucleotides of zinc finger 3, encoding the tripeptide Lys-Thr-Ser (KTS). The presence or absence of KTS within the zinc fingers of WT1 alters DNA binding.^ I have investigated transcriptional regulation of WT1, characterizing two means of repressing WT1 transcription. I have cloned a transcriptional silencer of the WT1 promoter which is located in the third intron of the WT1 gene. The silencer is 460 bp in length and contains an Alu repeat. The silencer functions in cells of non-renal origin.^ I have found that WT1 protein can autoregulate the WT1 promoter. Using the autoregulation of the WT1 promoter as a functional assay, I have defined differential consensus DNA binding motifs of WT1 isoforms lacking and containing the KTS tripeptide insertion. With these refined consensus DNA binding motifs, I have identified two additional targets of WT1 transcriptional repression, the proto-oncogenes bcl-2 and c-myc.^ I have investigated the ability of the alternatively spliced exon 5 to influence cell growth. In cell proliferation assays, isoforms of WT1 lacking exon 5 repress cell growth. WT1 isoforms containing exon 5 fail to repress cell growth to the same extent, but alter the morphology of the cells. These experiments demonstrate that the alternative splice isoforms of WT1 have differential effects on the function of WT1. These findings suggest a role for the alternative splicing of WT1 in metanephric development. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Spinal muscular atrophy (SMA) is a fatal motor neuron disease of childhood that is caused by mutations in the SMN1 gene. Currently, no effective treatment is available. One possible therapeutic approach is the use of antisense oligos (ASOs) to redirect the splicing of the paralogous gene SMN2, thus increasing functional SMN protein production. Various ASOs with different chemical properties are suitable for these applications, including a morpholino oligomer (MO) variant with a particularly excellent safety and efficacy profile. OBJECTIVE: We investigated a 25-nt MO sequence targeting the negative intronic splicing silencer (ISS-N1) 10 to 34 region. METHODS: We administered a 25-nt MO sequence against the ISS-N1 region of SMN2 (HSMN2Ex7D[-10-34]) in the SMAΔ7 mouse model and evaluated the effect and neuropathologic phenotype. We tested different concentrations (from 2 to 24 nM) and delivery protocols (intracerebroventricular injection, systemic injection, or both). We evaluated the treatment efficacy regarding SMN levels, survival, neuromuscular phenotype, and neuropathologic features. RESULTS: We found that a 25-nt MO sequence against the ISS-N1 region of SMN2 (HSMN2Ex7D[-10-34]) exhibited superior efficacy in transgenic SMAΔ7 mice compared with previously described sequences. In our experiments, the combination of local and systemic administration of MO (bare or conjugated to octaguanidine) was the most effective approach for increasing full-length SMN expression, leading to robust improvement in neuropathologic features and survival. Moreover, we found that several small nuclear RNAs were deregulated in SMA mice and that their levels were restored by MO treatment. CONCLUSION: These results indicate that MO-mediated SMA therapy is efficacious and can result in phenotypic rescue, providing important insights for further development of ASO-based therapeutic strategies in SMA patients.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Drosophila Transformer-2 (Tra2) protein activates the splicing of doublesex and fruitless pre-mRNA and represses M1 intron splicing in its own RNA in male germline. The M1 retention is part of negative feedback mechanism that controls Tra2 protein synthesis. However it is not known how the M1 intron is repressed or why Tra2 activates splicing of some RNAs while repressing splicing in others. Here we show that Tra2 and SR protein Rbp1 function together to specifically repress M1 splicing in vitro through the same intronic silencer by binding independently to distinct sites. The role of Rbp1 in M1 repression in vivo was validated by the finding that increased expression of Rbp1 in S2 cells promotes M1 retention. Furthermore, Tra2 blocks prespliceosomal A complex formation, a step corresponding to U2 snRNP recruitment to the branchpoint. High levels of Tra2 repression require an upstream enhancer. Together, we propose that the complex formed by Tra2 and Rbp1 on the silencer achieves splicing repression by blocking the recognition of the branchpoint or antagonizing enhancer function. ^ In addition, both splicing regulatory activities of Tra2 are essential developmental events, doublesex splicing is the key for Drosophila sex determination in the soma, while M1 retention occurs in the male germline and is necessary for spermatogenesis. However, active Tra2 is expressed ubiquitously. So another issue we have studied is how Tra2 accomplishes negative and positive splicing regulation in a tissue-specific fashion. Surprisingly, we found that nuclear extract from somatically-derived S2 cells support M1 repression in vitro. This led us to hypothesize that no germline specific factor is required and that high levels of Tra2 expression in the male germline is sufficient to trigger M1 retention. To test it, I examined whether increased expression of Tra2 could promote M1 retention in cells outside male germline. My results show that increased Tra2 expression promotes M1 retention in somatically-derived S2 cells as well as in the somatic tissues of living flies. These results show that somatic tissues are capable of supporting M1 repression but do not normally do so because the low levels of Tra2 do not trigger negative feedback regulation. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Alternative RNA splicing is a critical process that contributes variety to protein functions, and further controls cell differentiation and normal development. Although it is known that most eukaryotic genes produce multiple transcripts in which splice site selection is regulated, how RNA binding proteins cooperate to activate and repress specific splice sites is still poorly understood. In addition how the regulation of alternative splicing affects germ cell development is also not well known. In this study, Drosophila Transformer 2 (Tra2) was used as a model to explore both the mechanism of its repressive function on its own pre-mRNA splicing, and the effect of the splicing regulation on spermatogenesis in testis. Half-pint (Hfp), a protein known as splicing activator, was identified in an S2 cell-based RNAi screen as a co-repressor that functions in combination with Tra2 in the splicing repression of the M1 intron. Its repressive splicing function is found to be sequence specific and is dependent on both the weak 3’ splice site and an intronic splicing silencer within the M1 intron. In addition we found that in vivo, two forms of Hfp are expressed in a cell type specific manner. These alternative forms differ at their amino terminus affecting the presence of a region with four RS dipeptides. Using assays in Drosophila S2 cells, we determined that the alternative N terminal domain is necessary in repression. This difference is probably due to differential localization of the two isoforms in the nucleus and cytoplasm. Our in vivo studies show that both Hfp and Tra2 are required for normal spermatogenesis and cooperate in repression of M1 splicing in spermatocytes. But interestingly, Tra2 and Hfp antagonize each other’s function in regulating germline specific alternative splicing of Taf1 (TBP associated factor 1). Genetic and cytological studies showed that mutants of Hfp and Taf1 both cause similar defects in meiosis and spermatogenesis. These results suggest Hfp regulates normal spermatogenesis partially through the regulation of taf1 splicing. These observations indicate that Hfp regulates tra2 and taf1 activity and play an important role in germ cell differentiation of male flies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^