988 resultados para interleukin 5
Resumo:
Background Bahia grass pollen (BaGP) is a major cause of allergic rhinitis. Subcutaneous allergen-specific immunotherapy is effective for grass pollen allergy, but is unsuitable for patients with moderate to severe asthma due to the risk of anaphylaxis. T cell-reactive but IgE nonreactive peptides provide a safer treatment option. This study aimed to identify and characterize dominant CD4+ T cell epitope peptides of the major BaGP allergen, Pas n 1. Methods Pas n 1-specific T cell lines generated from the peripheral blood of BaGP-allergic subjects were tested for proliferative and cytokine response to overlapping 20-mer Pas n 1 peptides. Cross-reactivity to homologous peptides from Lol p 1 and Cyn d 1 of Ryegrass and Bermuda grass pollen, respectively, was assessed using Pas n 1 peptide-specific T cell clones. MHC class II restriction of Pas n 1 peptide T cell recognition was determined by HLA blocking assays and peptide IgE reactivity tested by dot blotting. Results Three Pas n 1 peptides showed dominant T cell reactivity; 15 of 18 (83%) patients responded to one or more of these peptides. T cell clones specific for dominant Pas n 1 peptides showed evidence of species-specific T cell reactivity as well as cross-reactivity with other group 1 grass pollen allergens. The dominant Pas n 1 T cell epitope peptides showed HLA binding diversity and were non-IgE reactive. Conclusions The immunodominant T cell-reactive Pas n 1 peptides are candidates for safe immunotherapy for individuals, including those with asthma, who are allergic to Bahia and possibly other grass pollens.
Resumo:
Many efforts are currently made to prepare combined vaccines against most infectious pathogens, that may be administered early in life to protect infants against infectious diseases as early as possible. However, little is known about the general immune modulation induced by early vaccination. Here, we have analyzed the cytokine secretion profiles of two groups of 6-month-old infants having received as primary immunization either a whole-cell (Pw) or an acellular (Pa) pertussis vaccine in a tetravalent formulation of pertussis-tetanus-diphtheria-poliomyelitis vaccines. Both groups of infants secreted IFN-gamma in response to the Bordetella pertussis antigens filamentous haemagglutinin and pertussis toxin, and this response was correlated with antigen-specific IL-12p70 secretion, indicating that both pertussis vaccines induced Th1 cytokines. However, Pa recipients also developed a strong Th2-type cytokine response to the B. pertussis antigens, as noted previously. In addition, they induced Th2-type cytokines to the co-administrated antigen tetanus toxoïd, as well as to the food antigen beta-lactoglobulin. Furthermore, the general cytokine profile of the Pa recipients was strongly Th2-skewed at 6 months, as indicated by the cytokines induced by the mitogen phytohaemagglutinin. These data demonstrate that the cytokine profile of 6-month-old infants is influenced by the type of formulation of the pertussis vaccine they received at 2, 3 and 4 months of life. Large prospective studies would be warranted to evaluate the possible long-term consequences of this early modulation of the cytokine responses in infants.
Resumo:
Based on studies reporting specific antibody titers, it is recommended to vaccinate preterm infants against Bordetella pertussis according to their chronological age. However, as specific T-cell responses also are involved in the protection against B. pertussis, we have determined whether highly preterm infants (<31 weeks) are able to mount these immune responses during vaccination. Forty-eight premature infants were vaccinated at 2, 3, and 4 months of their chronological age with an acellular (Pa; n = 24) or a whole-cell (Pw; n = 24) tetravalent diphtheria-tetanus-pertussis-polio vaccine, and blood samples were collected at 2, 3, and 6 months of age. Most of the Pa- and Pw-vaccinated infants developed at 3 or 6 months of age a gamma interferon (IFN-gamma) response to the B. pertussis antigens, accompanied by an interleukin-5 (IL-5) and IL-13 secretion for the Pa-vaccinated infants. No association was found between a very low infant birth weight, the occurrence of severe infections, and corticosteroid treatment or the administration of gammaglobulins with a low level of antigen-induced IFN-gamma secretion. We conclude that like full-term infants, most preterm infants are able to mount a specific cellular immune response to the administration of the first doses of an acellular or a whole-cell pertussis vaccine.
Resumo:
Asthma is a chronic respiratory disease characterized by airway inflammation and airway hyperresponsiveness (AHR). One strategy to treat allergic diseases is the development of new drugs. Flavonoids are compounds derived from plants and are known to have antiallergic, anti-inflammatory, and antioxidant properties. To investigate whether the flavonoid kaempferol glycoside 3-O-[beta-D-glycopiranosil-(1 -> 6)-alpha-L-ramnopiranosil]-7-O-alpha-L-ramnopiranosil-kaempferol (GRRK) would be capable of modulating allergic airway disease (AAD) either as a preventive (GRRK P) or curative (GRRK C) treatment in an experimental model of asthma. At weekly intervals, BALB/c mice were subcutaneously (sc) sensitized twice with ovalbumin (OVA)/alum and challenged twice with OVA administered intranasally. To evaluate any preventive effects GRRK was administered 1 h (hour) before each OVA-sensitization and challenge, while to analyze the curative effects mice were first sensitized with OVA, followed by GRRK given at day 18 through 21. The onset: of AAD was evaluated 24 h after the last OVA challenge. Both treatments resulted in a dose-dependent reduction in total leukocyte and eosinophil counts in the bronchoalveolar lavage fluid (BAL). GRRK also decreased CD4(+), B220(+), MHC class II and CD40 molecule expressions in BAL cells. Histology and lung mechanic showed that GRRK suppressed mucus production and ameliorated the AHR induced by OVA challenge. Furthermore, GRRK impaired Th2 cytokine production (IL-5 and IL-13) and did not induce a Th1 pattern of inflammation. These findings demonstrate that GRRK treatment before or after established allergic lung disease down-regulates key asthmatic features. Therefore. GRRK has a potential clinical use for the treatment of allergic asthma. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
Background: Vaccination of neonates is generally difficult due to the immaturity of the immune system and consequent higher susceptibility to tolerance induction. Genetic immunization has been described as an alternative to trigger a stronger immune response in neonates, including significant Th1 polarization. In this investigation we analysed the potential use of a genetic vaccine containing the heat shock protein (hsp65) from Mycobacterium leprae (pVAXhsp65) against tuberculosis (TB) in neonate mice. Aspects as antigen production, genomic integration and immunogenicity were evaluated. Methods: Hsp65 message and genomic integration were evaluated by RT-PCR and Southern blot, respectively. Immunogenicity of pVAXhsp65 alone or combined with BCG was analysed by specific induction of antibodies and cytokines, both quantified by ELISA. Results: This DNA vaccine was transcribed by muscular cells of neonate mice without integration into the cellular genome. Even though this vaccine was not strongly immunogenic when entirely administered (three doses) during early animal's life, it was not tolerogenic. In addition, pVAXhsp65 and BCG were equally able to prime newborn mice for a strong and mixed immune response (Th1 + Th2) to pVAXhsp65 boosters administered later, at the adult life. Conclusion: These results suggest that pVAXhsp65 can be safely used as a priming stimulus in neonate animals in prime-boost similar strategies to control TB. However, priming with BCG or pVAXhsp65, directed the ensuing immune response triggered by an heterologous or homologous booster, to a mixed Th1/Th2 pattern of response. Measures as introduction of IL-12 or GM-CSF genes in the vaccine construct or even IL-4 neutralization, are probably required to increase the priming towards Th1 polarization to ensure control of tuberculosis infection. © 2007 Pelizon et al; licensee BioMed Central Ltd.
Resumo:
Epidemiological and experimental studies support the idea that helminth infections can induce a protective effect against the development of autoimmune and allergic diseases. In this study we characterized the immune response induced by Strongyloides venezuelensis infection in C57BL/6 mice and then evaluated the effect of a previous contact with this helminth in the outcome of type 1 diabetes. Animals were initially infected with 2000 L3 larvae from S. venezuelensis and euthanized 22. days later. An acute phase, identified by a high amount of eggs per gram of feces, was established between days 7 and 9 post-infection. Recovery from infection was associated with a Th2 polarized response characterized by a significant level of serum IgG1 specific antibodies and also a significant production of IL-5 and IL-10 by spleen cells stimulated with S. venezuelensis soluble antigen. Immunization with soluble S. venezuelensis antigen associated with complete Freund's adjuvant followed by infection with S. venezuelensis protected mice from diabetes development induced by streptozotocin. Protection was characterized by a higher body weight gain, lower glycemic levels, much less severe insulitis and preserved insulin production. Together, these results indicate that S. venezuelensis contributed to protect C57BL/6 mice against experimental diabetes induced by streptozotocin. © 2013 Elsevier Inc.
Resumo:
Apoptosis is the most common form of physiological cell death and a necessary process to maintain cell numbers in multicellular organisms. Eosinophils are constantly produced in the bone marrow and the same numbers die, under normal circumstances, within a relatively short time period. In many eosinophilic inflammatory diseases, reduced eosinophil apoptosis has been described. This mechanism may contribute to increased eosinophil numbers, a phenomenon called eosinophilia. Overexpression of interleukin-5 appears to be crucial for delaying eosinophil apoptosis in many allergic disorders. Survival factor withdrawal leads to the induction of apoptosis. Besides survival cytokines, eosinophil apoptosis is also regulated by death factors. Recent observations suggest a role for mitochondria in conducting eosinophil apoptosis, although the mechanisms that trigger mitochondria to release proapoptotic factors remain less clear. Drugs that specifically induce eosinophil apoptosis might be useful for triggering the resolution of unwanted eosinophilic inflammatory responses.
Resumo:
BACKGROUND: The hypereosinophilic syndrome is a group of diseases characterized by persistent blood eosinophilia, defined as more than 1500 cells per microliter with end-organ involvement and no recognized secondary cause. Although most patients have a response to corticosteroids, side effects are common and can lead to considerable morbidity. METHODS: We conducted an international, randomized, double-blind, placebo-controlled trial evaluating the safety and efficacy of an anti-interleukin-5 monoclonal antibody, mepolizumab, in patients with the hypereosinophilic syndrome. Patients were negative for the FIP1L1-PDGFRA fusion gene and required prednisone monotherapy, 20 to 60 mg per day, to maintain a stable clinical status and a blood eosinophil count of less than 1000 per microliter. Patients received either intravenous mepolizumab or placebo while the prednisone dose was tapered. The primary end point was the reduction of the prednisone dose to 10 mg or less per day for 8 or more consecutive weeks. RESULTS: The primary end point was reached in 84% of patients in the mepolizumab group, as compared with 43% of patients in the placebo group (hazard ratio, 2.90; 95% confidence interval [CI], 1.59 to 5.26; P<0.001) with no increase in clinical activity of the hypereosinophilic syndrome. A blood eosinophil count of less than 600 per microliter for 8 or more consecutive weeks was achieved in 95% of patients receiving mepolizumab, as compared with 45% of patients receiving placebo (hazard ratio, 3.53; 95% CI, 1.94 to 6.45; P<0.001). Serious adverse events occurred in seven patients receiving mepolizumab (14 events, including one death; mean [+/-SD] duration of exposure, 6.7+/-1.9 months) and in five patients receiving placebo (7 events; mean duration of exposure, 4.3+/-2.6 months). CONCLUSIONS: Our study shows that treatment with mepolizumab, an agent designed to target eosinophils, can result in corticosteroid-sparing for patients negative for FIP1L1-PDGFRA who have the hypereosinophilic syndrome. (ClinicalTrials.gov number, NCT00086658 [ClinicalTrials.gov].).
Resumo:
Although eosinophils are considered useful in defense mechanisms against parasites, their exact function in innate immunity remains unclear. The aim of this study is to better understand the role of eosinophils within the gastrointestinal immune system. We show here that lipopolysaccharide from Gram-negative bacteria activates interleukin-5 (IL-5)- or interferon-gamma-primed eosinophils to release mitochondrial DNA in a reactive oxygen species-dependent manner, but independent of eosinophil death. Notably, the process of DNA release occurs rapidly in a catapult-like manner--in less than one second. In the extracellular space, the mitochondrial DNA and the granule proteins form extracellular structures able to bind and kill bacteria both in vitro and under inflammatory conditions in vivo. Moreover, after cecal ligation and puncture, Il5-transgenic but not wild-type mice show intestinal eosinophil infiltration and extracellular DNA deposition in association with protection against microbial sepsis. These data suggest a previously undescribed mechanism of eosinophil-mediated innate immune responses that might be crucial for maintaining the intestinal barrier function after inflammation-associated epithelial cell damage, preventing the host from uncontrolled invasion of bacteria.
Resumo:
Mutation of Bruton’s tyrosine kinase (Btk) impairs B cell maturation and function and results in a clinical phenotype of X-linked agammaglobulinemia. Activation of Btk correlates with an increase in the phosphorylation of two regulatory Btk tyrosine residues. Y551 (site 1) within the Src homology type 1 (SH1) domain is transphosphorylated by the Src family tyrosine kinases. Y223 (site 2) is an autophosphorylation site within the Btk SH3 domain. Polyclonal, phosphopeptide-specific antibodies were developed to evaluate the phosphorylation of Btk sites 1 and 2. Crosslinking of the B cell antigen receptor (BCR) or the mast cell Fcɛ receptor, or interleukin 5 receptor stimulation each induced rapid phosphorylation at Btk sites 1 and 2 in a tightly coupled manner. Btk molecules were singly and doubly tyrosine-phosphorylated. Phosphorylated Btk comprised only a small fraction (≤5%) of the total pool of Btk molecules in the BCR-activated B cells. Increased dosage of Lyn in B cells augmented BCR-induced phosphorylation at both sites. Kinetic analysis supports a sequential activation mechanism in which individual Btk molecules undergo serial transphosphorylation (site 1) then autophosphorylation (site 2), followed by successive dephosphorylation of site 1 then site 2. The phosphorylation of conserved tyrosine residues within structurally related Tec family kinases is likely to regulate their activation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Background: Between 1961-1971 vitamin D deficiency was recognized as a public health issue in the UK, because of the lack of effective sunlight and the population mix [1, 2]. In recent years, health care professionals have cited evidence suggesting a re-emergence of the vitamin D deficiency linked to a number of health consequences as a concern [3-6]. Evidence from observational studies has linked low vitamin D status with impairment in glucose homeostasis and immune dysfunction [7-9]. However, interventional studies, particularly those focused on paediatric populations, have been limited and inconsistent. There is a need for detailed studies, to clarify the therapeutic benefits of vitamin D in these important clinical areas. Objective: The aims of this PhD thesis were two-fold. Firstly, to perform preliminary work assessing the association between vitamin D deficiency and bone status, glucose homeostasis and immune function, and to explore any changes in these parameters following short term vitamin D3 replacement therapy. Secondly, to assess the effectiveness of an electronic surveillance system (ScotPSU) as a tool to determine the current incidence of hospital-based presentation of childhood vitamin D deficiency in Scotland. Methods: Active surveillance was performed for a period of two years as a part of an electronic web-based surveillance programme performed by the Scottish Paediatric Surveillance Unit (ScotPSU). The validity of the system was assessed by identifying cases with profound vitamin D deficiency (in Glasgow and Edinburgh) from the regional laboratory. All clinical details were checked against those identified using the surveillance system. Thirty-seven children aged 3 months to 10 years, who had been diagnosed with vitamin D deficiency, were recruited for the bone, glucose and immunity studies over a period of 24 months. Twenty-five samples were analysed for the glucose and bone studies; of these, 18 samples were further analysed for immune study. Treatment consisted of six weeks taking 5000 IU units cholecalciferol orally once a day. At baseline and after completion of treatment, 25 hydroxyvitamin D (25(OH)D), parathyroid hormone (PTH), alkaline phosphatase (ALP), collagen type 1 cross-linked C-telopeptide (CTX), osteocalcin (OCN), calcium, phosphate, insulin, glucose, homeostasis model assessment index, estimated insulin resistance (HOMA IR), glycated hemoglobin (HbA1c), sex hormone binding globulin (SHBG), lipids profiles, T helper 1 (Th1) cytokines (interleukin-2 ( IL-2), tumor necrosis factors-alpha (TNF-α), interferon-gamma (INF-γ)), T helper 2 (Th2) cytokines (interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6)), T helper 17 (Th17) cytokine (interleukin-17 (IL-17)), Regulatory T (Treg) cytokine (interleukin-10 (IL-10)) and chemokines/cytokines, linked with Th1/Th2 subset balance and/or differentiation (interleukin-8 (IL-8), interleukin-12 (IL-12), eosinophil chemotactic protein ( EOTAXIN), macrophage inflammatory proteins-1beta (MIP-1β), interferon-gamma-induced protein-10 (IP-10), regulated on activation, normal T cell expressed and secreted (RANTES), monocyte chemoattractant protein-1(MCP-1)) were measured. Leukoocyte subset analysis was performed for T cells, B cells and T regulatory cells and a luminex assay was used to measure the cytokiens. Results: Between September 2009 and August 2011, 163 cases of vitamin D deficiency were brought to the attention of the ScotPSU, and the majority of cases (n = 82) were reported in Glasgow. The cross-validation checking in Glasgow and Edinburgh over a one-year period revealed only 3 (11%) cases of clearly symptomatic vitamin D deficiency, which had been missed by the ScotPSU survey in Glasgow. While 16 (67%) symptomatic cases had failed to be reported through the ScotPSU survey in Edinburgh. For the 23 children who are included in bone and glucose studies, 22 (96%) children had basal serum 25(OH)D in the deficiency range (< 50 nmol/l) and one (4%) child had serum 25(OH)D in the insufficiency range (51-75 nmol/l). Following vitamin D3 treatment, 2 (9%) children had final serum 25(OH)D lower than 50 nmol/l, 6 (26%) children had final serum 25(OH)D between >50-75 nmol/l, 12 (52%) children reached a final serum 25(OH)D >75-150 nmol/l and finally 3 (13%) exceeded the normal reference range with a final 25(OH)D >150 nmol/l. Markers for remodelling ALP and PTH had significantly decreased (p = 0.001 and <0.0001 for ALP and PTH respectively). In 17 patients for whom insulin and HOMA IR data were available and enrolled in glucose study, significant improvements in insulin resistance (p = 0.04) with a trend toward a reduction in serum insulin (p = 0.05) was observed. Of those 14 children who had their cytokines profile data analysed and enrolled in the immunity study, insulin and HOMA IR data were missed in one child. A significant increase in the main Th2 secreted cytokine IL-4 (p = 0.001) and a tendency for significant increases in other Th2 secreted cytokines IL-5 (p = 0.05) and IL-6 (p = 0.05) was observed following vitamin D3 supplementation. Conclusion: An electronic surveillance system can provide data for studying the epidemiology of vitamin D deficiency. However, it may underestimate the number of positive cases. Improving vitamin D status in vitamin D deficient otherwise healthy children significantly improved their vitamin D deficient status, and was associated with an improvement in bone profile, improvements in insulin resistance and an alteration in main Th2 secreting cytokines.
Resumo:
Differential activation of CD4+ T-cell precursors in vivo leads to the development of effectors with unique patterns of lymphokine secretion. To investigate whether the differential pattern of lymphokine secretion is influenced by factors associated with either the display and/or recognition of the ligand, we have used a set of ligands with various class II binding affinities but unchanged T-cell specificity. The ligand that exhibited approximately 10,000-fold higher binding to I-Au considerably increased the frequency of interferon gamma-producing but not interleukin (IL) 4- or IL-5-secreting cells in vivo. Using an established ligand-specific, CD4+ T-cell clone secreting only IL-4, we also demonstrated that stimulation with the highest affinity ligand resulted in interferon gamma production in vitro. In contrast, ligands that demonstrated relatively lower class II binding induced only IL-4 secretion. These data suggest that the major histocompatibility complex binding affinity of antigenic determinants, leading to differential interactions at the T cell-antigen-presenting cell interface, can be crucial for the differential development of cytokine patterns in T cells.
Resumo:
To explore the possible involvement of STAT factors ("signal transducers and activators of transcription") in the interleukin 2 receptor (IL-2R) signaling cascade, murine HT-2 cells expressing chimeric receptors composed of the extracellular domain of the erythropoietin receptor fused to the cytoplasmic domains of the IL-2R beta or -gamma c chains were prepared. Erythropoietin or IL-2 activation of these cells resulted in rapid nuclear expression of a DNA-binding activity that reacted with select STAT response elements. Based on reactivity with specific anti-STAT antibodies, this DNA-binding activity was identified as a murine homologue of STAT-5. Induction of nuclear expression of this STAT-5-like factor was blocked by the addition of herbimycin A, a tyrosine kinase inhibitor, but not by rapamycin, an immunophilin-binding antagonist of IL-2-induced proliferation. The IL-2R beta chain appeared critical for IL-2-induced activation of STAT-5, since a mutant beta chain lacking all cytoplasmic tyrosine residues was incapable of inducing this DNA binding. In contrast, a gamma c mutant lacking all of its cytoplasmic tyrosine residues proved fully competent for the induction of STAT-5. Physical binding of STAT-5 to functionally important tyrosine residues within IL-2R beta was supported by the finding that phosphorylated, but not nonphosphorylated, peptides corresponding to sequences spanning Y392 and Y510 of the IL-2R beta tail specifically inhibited STAT-5 DNA binding.