Experimental analysis and adherence test of the electromagnetic zero-sequence blocking model

This paper reveals new contributions to the analysis and development of mitigating harmonic distortion devices. Considering the variety of sequential distribution of harmonic current, in the use of passive filters, one can point out the electromagnetic blocking device, which have received particular attention due to its robustness and low cost of installation. In this context, aiming the evaluation of the reliability of the results obtained through mathematical modeling, experimental tests are carried out using a low-power prototype, highlighting particular aspects related to its function as a zero-sequence harmonic blocking. © 2011 IEEE.

The sensitivity and specificity of a diagnostic test of sequence-space synesthesia

People with sequence-space synesthesia (SSS) report stable visuo-spatial forms corresponding to numbers, days, and months (amongst others). This type of synesthesia has intrigued scientists for over 130 years but the lack of an agreed upon tool for assessing it has held back research on this phenomenon. The present study builds on previous tests by measuring the consistency of spatial locations that is known to discriminate controls from synesthetes. We document, for the first time, the sensitivity and specificity of such a test and suggest a diagnostic cut-off point for discriminating between the groups based on the area bounded by different placement attempts with the same item.

Comparison between the 1% and 2% ibopamine provocative test in primary open-angle glaucoma patients: sensitivity, specificity and tolerability

PURPOSE: To compare intraocular pressure (IOP) rise in normal individuals and primary open-angle glaucoma patients and the safety and efficacy of ibopamine eye drops in different concentrations as a provocative test for glaucoma. METHODS: Glaucoma patients underwent (same eye) the ibopamine provocative test with two concentrations, 1% and 2%, in a random sequence at least 3 weeks apart, but not more than 3 months. The normal individuals were randomly submitted to one of the concentrations of ibopamine (1% and 2%). The test was considered positive if there was an IOP rise greater than 3 or 4 mmHg at 30 or 45 minutes to test which subset of the test has the best sensitivity (Se)/specificity (Sp). RESULTS: There was no statistically significant difference in any of the IOP measurements, comparing 1% with 2% ibopamine. The IOP was significantly higher at 30 and 45 minutes with both concentrations (p<0.001). The best sensitivity/specificity ratio was achieved with the cutoff point set as greater than 3 mmHg at 45 minutes with 2% ibopamine (area under the ROC curve: 0.864, Se: 84.6%; Sp:73.3%). All patients described a slight burning after ibopamine's instillation. CONCLUSION: 2% ibopamine is recommended as a provocative test for glaucoma. Because both concentrations have similar ability to rise IOP, 1% ibopamine may be used to treat ocular hypotony.

Relative Bioavailability of Two Oral Formulations of Risperidone 2 mg: A Single-Dose, Randomized-Sequence, Open-Label, Two-Period Crossover Comparison in Healthy Brazilian Volunteers

Background: Risperidone (RSP) is a benzisoxazole antipsychotic agent used to treat schizophrenia and other psychiatric illnesses in adults and children (including those with autism). After oral administration, RSP is completely absorbed from the gastrointestinal tract and undergoes hydroxylation to yield 9-hydroxyrisperidone (9-OH-RSP), an active metabolite that has a pharmacologic profile and potency similar to RSP. Objectives: The aims of this study were to compare the relative bioavailability of a pharmaceutical-equivalent (test) formulation with a reference formulation of oral RSP 2 mg, both available commercially on the Brazilian pharmaceutical market, and to generate data regarding the oral bioavailability of the tested drug in healthy Brazilian volunteers. Methods: This single-dose, randomized-sequence, open-label, 2-period crossover study was conducted in healthy Brazilian volunteers from August to December 2008. Subjects were randomly assigned to receive the test formulation followed by the reference formulation or vice versa, with a 30-day washout period between doses. Study drugs were administered after a 12-hour overnight fast. For pharmacokinetic analysis, blood samples were drawn at 0 (baseline), 0.25, 0.5, 1, 1.5, 3, 5, 8, 12, 24, 48, 72, 96, and 120 hours after administration. Plasma concentrations of RSP and 9-OH-RSP were determined using LC-MS/MS. The test and reference formulations were to be considered bioequivalent if the 90% CIs for the geometric mean test/reference ratios were within a predetermined range of 80% to 125%, in accordance with the policies of the Brazilian Sanitary Surveillance Agency and the US Food and Drug Administration. Tolerability was determined using clinical assessments, monitoring of vital signs, analysis of laboratory test results, and subject interviews regarding adverse events. Results: A total of 22 subjects were enrolled (11 men, 11 women; mean [SD] age, 32 [12] years [range, 18-58 years]; weight, 70.4 [11.9] kg [range, 50-103 kg]; height, 1.67 [0.08] m [range, 1.56-1.80 m]; and body mass index, 25 [4] kg/m(2) [range, 18-29 kg/m(2)]). For RSP, mean (SD) C(max) values were 12.6 (2.7) and 16.0 (2.3) ng/mL for the test and reference formulations, respectively. For 9-OH-RSP, mean C(max) values were 17.8 (1.3) and 21.0 (1.7) ng/mL for the test and reference formulations. The 90% CIs for the mean test/reference ratios for RSP C(max), AUC(0-120), and AUC(0-infinity) were 74% to 82%, 75% to 85%, and 76% to 85%, respectively, and 83% to 87%, 75% to 79%, and 75% to 78% for 9-OH-RSP. The related adverse events (headache, low back pain, drowsiness, standing hypotension, local postvenipuncture ecchymoses, insomnia, nausea, and vomiting) were transient and mild. Conclusions: This single-dose study found that the test and reference formulations of oral RSP 2 mg did not meet the Brazilian and US regulatory criteria for bioequivalence in these fasting, healthy volunteers. The study formulations appeared to be well tolerated. (Clin Ther 2010;32:2106-2115) (C) 2010 Elsevier HS Journals, Inc.

CYP3A activity measured by the midazolam test is not related to 3435 C >T polymorphism in the multiple drug resistance transporter gene.

A recent study with 69 Japanese liver transplants treated with tacrolimus found that the MDR13435 C >T polymorphism, but not the MDR12677 G >T polymorphism, was associated with differences in the intestinal expression level of CYP3A4 mRNA. In the present study, over 6 h, we measured the kinetics of a 75 microg oral dose of midazolam, a CYP3A substrate, in 21 healthy subjects genotyped for the MDR13435 C >T and 2677 G >T polymorphism. No statistically significant differences were found in the calculated pharmacokinetic parameters between the three 3435 C >T genotypes (TT, CT and CC group, respectively: Cmax (mean +/- SD: 0.30 +/- 0.08 ng/ml, 0.31 +/- 0.09 ng/ml and 0.31 +/- 0.11 ng/ml; Apparent clearance: 122 +/- 29 l/h, 156 +/- 92 l/h and 111 +/- 35 l/h; t1/2: 1.9 +/- 1.1 h, 1.6 +/- 0.90 h and 1.7 +/- 0.7 h). In addition, the 30-min 1'OH midazolam to midazolam ratio, a marker of CYP3A activity, determined in 74 HIV-positive patients before the introduction of antiretroviral treatment, was not significantly different between the three 3435 C >T genotypes (mean ratio +/- SD: 3.65 +/- 2.24, 4.22 +/- 3.49 and 4.24 +/- 2.03, in the TT, CT and CC groups, respectively). Similarly, no association was found between the MDR12677 G >T polymorphism and CYP3A activity in the healthy subjects or in the HIV-positive patients. The existence of a strong association between the activity of CYP3A and MDR13435 C >T and 2677 G >T polymorphisms appears unlikely, at least in Caucasian populations and/or in the absence of specific environmental factors.

CTCF-T, a paralogue of CTCF, directs sequence specific DNA methylation of the imprinting control region of Igf2/H19

SUMMARY Genomic imprinting is an epigenetic mechanism of transcriptional regulation that ensures restriction of expression of a subset of mammalian genes to a single parental allele. The best studied example of imprinted gene regulation is the Igf2/H19 locus, which is also the most commonly altered by loss of imprinting (LOT) in cancer. LOT is associated with numerous hereditary diseases and several childhood, and adult cancers. Differential expression of reciprocal H19 and 1gf2 alleles in somatic cells depends on the methylation status of the imprinting control region (ICR) which regulates binding of CTCF, an ubiquitously expressed 11-zinc finger protein that binds specifically to non-methylated maternal ICR and thereby attenuates expression of Igf2, while it does not bind to methylated paternal ICR, which enables Igf2 expression. Initial ICR methylation occurs during gametogenesis by an as yet unknown mechanism. The accepted hypothesis is that the event of differential maternal and paternal DNA methylation depends on germ-line specific proteins. Our Laboratory identified a novel 11-zinc-finger protein CTCF-T (also known as CTCFL and BORIS) that is uniquely expressed in the male germ-line and is highly homologous within its zinc-finger region with CTCF. The amino-acid sequences flanking the zinc-finger regions of CTCF and CTCF-T have widely diverged, suggesting that though they could bind to the same DNA targets (ICRs) they are likely to have different functions. Interestingly, expression of CTCF-T and CTCF is mutually exclusive; CTCF-T-positive (CTCF-negative) cells occur in the stage of spermatogenesis that coincides with epigenetic reprogramming, including de novo DNA methylation. In our study we demonstrate the role that CTCF-T plays in genomic imprinting. Here we show that CTCF-T binds in vivo to the ICRs of Igf2/H19 and Dlk/Gt12 imprinted genes. In addition, we identified two novel proteins interacting with CTCF-T: a protein arginine methyltransferase PRMT7 and an arginine-rich histone H2A variant that we named trH2A. These interactions were confirmed and show that the two proteins interact with the amino-teiminal region of CTCF-T. Additionally, we show interaction of the amino- terminal region of CTCF-T with histones H1, H2A and H3. These results suggest that CTCF-T is a sequence-specific DNA (ICR) binding protein that associates with histones and recruits PRMT7. Interestingly, PRMT7 has a histone-methyltransferase activity. It has been shown that histone methylation can mark chromatin regions thereby directing DNA-methylation; thus, our hypothesis is that the CTCF-T protein-scaffold directs PRMT7 to methylate histone(s) assembled on ICRs, which marks chromatin for the recruitment of the de novo DNA methyltransferases to methylate DNA. To test this hypothesis, we developed an in vivo DNA-methylation assay using Xenopus laevis' oocytes, where H19 ICR and different expression cDNAs, including CTCF-T, PRMT7 and the de novo DNA methyltransferases (Dnmt3a, Dnmt3b and Dnmt3L) are microinjected into the nucleus. The methylation status of CpGs within the H19 ICR was analysed 48 or 72 hours after injection. Here we demonstrate that CpGs in the ICR are methylated in the presence of both CTCF-T and PRMT7, while control oocytes injected only with ICR did not show any methylation. Additionally, we showed for the first time that Dnmt3L is crucial for the establishment of the imprinting marks on H19 ICR. Moreover, we confirmed that Dnmt3a and Dnmt3b activities are complementary. Our data indicate that all three Dnmt3s are important for efficient de novo DNA methylation. In conclusion, we propose a mechanism for the establishment of de novo imprinting marks during spermatogenesis: the CTCF-T/PRMT7 protein complex directs histone methylation leading to sequence-specific de novo DNA methylation of H19 ICR. RESUME L'empreinte génomique parentale est un mécanisme épigénétique de régulation transcriptionelle qui se traduit par une expression différentielle des deux allèles de certains gènes, en fonction de leur origine parentale. L'exemple le mieux caractérisé de gènes soumis à l'empreinte génomique parentale est le locus Igf2/H19, qui est aussi le plus fréquemment altéré par relaxation d'empreinte (en anglais: loss of imprinting, LOI) dans les cancers. Cette relaxation d'empreinte est aussi associée à de nombreuses maladies héréditaires, ainsi qu'à de nombreux cancers chez l'enfant et l'adulte. Dans les cellules somatiques, les différences d'expression des allèles réciproques H19 et Ig12 est sous le contrôle d'une région ICR (Imprinting Control Region). La méthylation de cette région ICR régule l'ancrage de la protéine à douze doigts de zinc CTCF, qui se lie spécifiquement à l'ICR maternel non-méthylé, atténuant ainsi l'expression de Igf2, alors qu'elle ne s'ancre pas à l'ICR paternel méthyle. Le mécanisme qui accompagne la méthylation initiale de la région ICR durant la gamétogenèse n'a toujours pas été élucidé. L'hypothèse actuelle propose que la différence de méthylation entre l'ADN maternel et paternel résulte de l'expression de protéines propres aux zones germinales. Notre laboratoire a récemment identifié une nouvelle protéine à douze doigts de zinc, CTCF-T (aussi dénommée CTCFL et BORRIS), qui est exprimée uniquement dans les cellules germinales mâles, dont la partie à douze doigts de zinc est fortement homologue à la protéine CTCF. La séquence d'acides aminés de part et d'autre de cette région est quant à elle très divergente, ce qui implique que CTCF-T se lie sans doute au même ADN cible que CTCF, mais possède des fonctions différentes. De plus, l'expression de CTCF-T et de CTCF s'oppose mutuellement; l'expression de la protéine CTCF-T (cellules CTCF-T positives, CTCF negatives) qui a lieu pendant la spermatogenèse coïncide avec la reprogrammation épigénétique, notamment la méthylation de novo de l'ADN. La présente étude démontre le rôle essentiel joué par la protéine CTCF-T dans l'acquisition de l'empreinte génomique parentale. Nous montrons ici que CTCF-T s'associe in vivo avec les régions ICR des loci Igf2/H19 et Dlk/Gt12. Nous avons également identifié deux nouvelles protéines qui interagissent avec CTCF-T : une protéine arginine méthyl transférase PRMT7, et un variant de l'histone H2A, riche en arginine, que nous avons dénommé trH2A. Ces interactions ont été analysées plus en détail, et confinnent que ces deux protéines s'associent avec la région N-terminale de CTCF-T. Aussi, nous présentons une interaction de la région N-terminale de CTCF-T avec les histones H1, H2, et H3. Ces résultats suggèrent que CTCF-T est une protéine qui se lie spécifiquement aux régions ICR, qui s'associe avec différents histones et qui recrute PRMT7. PRMT7 possède une activité méthyl-tansférase envers les histones. Il a été montré que la méthylation des histones marque certains endroits de la chromatine, dirigeant ainsi la méthylation de l'ADN. Notre hypothèse est donc la suivante : la protéine CTCF-T sert de base qui dirige la méthylation des histones par PRMT7 dans les régions ICR, ce qui contribue à marquer la chromatine pour le recrutement de nouvelles méthyl transférases pour méthyler l'ADN. Afin de valider cette hypothèse, nous avons développé un système de méthylation de l'ADN in vivo, dans des oeufs de Xenopus laevis, dans le noyau desquels nous avons mico-injecté la région ICR du locus H19, ainsi que différents vecteurs d'expression pour CTCF-T, PRMT7, et les de novo méthyl transférases (Dnmt3a, Dnmt3b et Dnmt3L). Les CpGs méthyles de la région ICR du locus H19 ont été analysé 48 et 72 heures après l'injection. Cette technique nous a permis de démontrer que les CpGs de la région ICR sont méthyles en présence de CTCF-T et de PRMT7, tandis que les contrôles injectés seulement avec la région ICR ne présentent aucun signe de méthylation. De plus, nous démontrons pour la première fois que la protéine méthyl transférase Dnmt3L est déterminant pour l'établissement de l'empreinte génomique parentale au niveau de la région ICR du locus H19. Aussi, nous confirmons que les activités méthyl transférases de Dnmt3a et Dnmt3b sont complémentaires. Nos données indiquent que les trois protéines Dnmt3 sont impliquées dans la méthylation de l'ADN. En conclusion, nous proposons un mécanisme responsable de la mise en place de nouvelles empreintes génomiques pendant la spermatogenèse : le complexe protéique CTCF-T/PRMT7 dirige la méthylation des histones aboutissant à la méthylation de novo de l'ADN au locus H19.

Fingermark Detection on Thermal Papers: Proposition of an Updated Processing Sequence

The detection of latent fingermarks on thermal papers proves to be particularly challenging because the application of conventional detection techniques may turn the sample dark grey or black, thus preventing the observation of fingermarks. Various approaches aiming at avoiding or solving this problem have been suggested. However, in view of the many propositions available in the literature, it gets difficult to choose the most advantageous method and to decide which processing sequence should be followed when dealing with a thermal paper. In this study, 19 detection techniques adapted to the processing of thermal papers were assessed individually and then were compared to each other. An updated processing sequence, assessed through a pseudo-operational test, is suggested.

Antimicrobial susceptibility determined by the E test, Löwenstein-Jensen proportion, and DNA sequencing methods among Mycobacterium tuberculosis isolates discrepancies, preliminary results

Mycobacterium tuberculosis strains resistant to streptomycin (SM), isoniazid (INH), and/or rifampin (RIF) as determined by the conventional Löwenstein-Jensen proportion method (LJPM) were compared with the E test, a minimum inhibitory concentration susceptibility method. Discrepant isolates were further evaluated by BACTEC and by DNA sequence analyses for mutations in genes most often associated with resistance to these drugs (rpsL, katG, inhA, and rpoB). Preliminary discordant E test results were seen in 75% of isolates resistant to SM and in 11% to INH. Discordance improved for these two drugs (63%) for SM and none for INH when isolates were re-tested but worsened for RIF (30%). Despite good agreement between phenotypic results and sequencing analyses, wild type profiles were detected on resistant strains mainly for SM and INH. It should be aware that susceptible isolates according to molecular methods might contain other mechanisms of resistance. Although reproducibility of the LJPM susceptibility method has been established, variable E test results for some M. tuberculosis isolates poses questions regarding its reproducibility particularly the impact of E test performance which may vary among laboratories despite adherence to recommended protocols. Further studies must be done to enlarge the evaluated samples and looked possible mutations outside of the hot spot sequenced gene among discrepant strains.

Phylogeny and circumscription of Sapindaceae revisited: molecular sequence data, morphology and biogeography support recognition of a new family, Xanthoceraceae

Background and aims Recent studies have adopted a broad definition of Sapindaceae that includes taxa traditionally placed in Aceraceae and Hippocastanaceae, achieving monophyly but yielding a family difficult to characterize and for which no obvious morphological synapomorphy exists. This expanded circumscription was necessitated by the finding that the monotypic, temperate Asian genus Xanthoceras, historically placed in Sapindaceae tribe Harpullieae, is basal within the group. Here we seek to clarify the relationships of Xanthoceras based on phylogenetic analyses using a dataset encompassing nearly 3/4 of sapindaceous genera, comparing the results with information from morphology and biogeography, in particular with respect to the other taxa placed in Harpullieae. We then re-examine the appropriateness of maintaining the current broad, morphologically heterogeneous definition of Sapindaceae and explore the advantages of an alternative family circumscription. Methods Using 243 samples representing 104 of the 142 currently recognized genera of Sapindaceae s. lat. (including all in Harpullieae), sequence data were analyzed for nuclear (ITS) and plastid (matK, rpoB, trnD-trnT, trnK-matK, trnL-trnF and trnS-trnG) markers, adopting the methodology of a recent family-wide study, performing single-gene and total evidence analyses based on maximum likelihood (ML) and maximum parsimony (MP) criteria, and applying heuristic searches developed for large datasets, viz, a new strategy implemented in RAxML (for ML) and the parsimony ratchet (for MP). Bootstrap analyses were performed for each method to test for congruence between markers. Key results Our findings support earlier suggestions that Harpullieae are polyphyletic: Xanthoceras is confirmed as sister to all other sampled taxa of Sapindaceae s. lat.; the remaining members belong to three other clades within Sapindaceae s. lat., two of which correspond respectively to the groups traditionally treated as Aceraceae and Hippocastanaceae, together forming a clade sister to the largely tropical Sapindaceae s. str., which is monophyletic and morphologically coherent provided Xanthoceras is excluded. Conclusion To overcome the difficulties of a broadly circumscribed Sapindaceae, we resurrect the historically recognized temperate families Aceraceae and Hippocastanaceae, and describe a new family, Xanthoceraceae, thus adopting a monophyletic and easily characterized circumscription of Sapindaceae nearly identical to that used for over a century.

Spatially selective implementation of the adiabatic T2 prep sequence for magnetic resonance angiography of the coronary arteries.

In coronary magnetic resonance angiography, a magnetization-preparation scheme for T2 -weighting (T2 Prep) is widely used to enhance contrast between the coronary blood-pool and the myocardium. This prepulse is commonly applied without spatial selection to minimize flow sensitivity, but the nonselective implementation results in a reduced magnetization of the in-flowing blood and a related penalty in signal-to-noise ratio. It is hypothesized that a spatially selective T2 Prep would leave the magnetization of blood outside the T2 Prep volume unaffected and thereby lower the signal-to-noise ratio penalty. To test this hypothesis, a spatially selective T2 Prep was implemented where the user could freely adjust angulation and position of the T2 Prep slab to avoid covering the ventricular blood-pool and saturating the in-flowing spins. A time gap of 150 ms was further added between the T2 Prep and other prepulses to allow for in-flow of a larger volume of unsaturated spins. Consistent with numerical simulation, the spatially selective T2 Prep increased in vivo human coronary artery signal-to-noise ratio (42.3 ± 2.9 vs. 31.4 ± 2.2, n = 22, P < 0.0001) and contrast-to-noise-ratio (18.6 ± 1.5 vs. 13.9 ± 1.2, P = 0.009) as compared to those of the nonselective T2 Prep. Additionally, a segmental analysis demonstrated that the spatially selective T2 Prep was most beneficial in proximal and mid segments where the in-flowing blood volume was largest compared to the distal segments. Magn Reson Med, 2013. © 2012 Wiley Periodicals, Inc.

Improved HIV-1 RNA quantitation by COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, v2.0 using a novel dual-target approach.

BACKGROUND: HIV-1 RNA viral load is a key parameter for reliable treatment monitoring of HIV-1 infection. Accurate HIV-1 RNA quantitation can be impaired by primer and probe sequence polymorphisms as a result of tremendous genetic diversity and ongoing evolution of HIV-1. A novel dual HIV-1 target amplification approach was realized in the quantitative COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, v2.0 (HIV-1 TaqMan test v2.0) to cope with the high genetic diversity of the virus. OBJECTIVES AND STUDY DESIGN: The performance of the new assay was evaluated for sensitivity, dynamic range, precision, subtype inclusivity, diagnostic and analytical specificity, interfering substances, and correlation with the COBAS AmpliPrep/COBAS TaqMan HIV-1 (HIV-1 TaqMan test v1.0) predecessor test in patients specimens. RESULTS: The new assay demonstrated a sensitivity of 20 copies/mL, a linear measuring range of 20-10,000,000 copies/mL, with a lower limit of quantitation of 20 copies/mL. HIV-1 Group M subtypes and HIV-1 Group O were quantified within +/-0.3 log(10) of the assigned titers. Specificity was 100% in 660 tested specimens, no cross reactivity was found for 15 pathogens nor any interference for endogenous substances or 29 drugs. Good comparability with the predecessor assay was demonstrated in 82 positive patient samples. In selected clinical samples 35/66 specimens were found underquantitated in the predecessor assay; all were quantitated correctly in the new assay. CONCLUSIONS: The dual-target approach for the HIV-1 TaqMan test v2.0 enables superior HIV-1 Group M subtype coverage including HIV-1 Group O detection. Correct quantitation of specimens underquantitated in the HIV-1 TaqMan test v1.0 test was demonstrated.

What is what?: A simple time-domain test of long-memory vs. structural breaks

This paper proposes a new time-domain test of a process being I(d), 0 < d = 1, under the null, against the alternative of being I(0) with deterministic components subject to structural breaks at known or unknown dates, with the goal of disentangling the existing identification issue between long-memory and structural breaks. Denoting by AB(t) the different types of structural breaks in the deterministic components of a time series considered by Perron (1989), the test statistic proposed here is based on the t-ratio (or the infimum of a sequence of t-ratios) of the estimated coefficient on yt-1 in an OLS regression of ?dyt on a simple transformation of the above-mentioned deterministic components and yt-1, possibly augmented by a suitable number of lags of ?dyt to account for serial correlation in the error terms. The case where d = 1 coincides with the Perron (1989) or the Zivot and Andrews (1992) approaches if the break date is known or unknown, respectively. The statistic is labelled as the SB-FDF (Structural Break-Fractional Dickey- Fuller) test, since it is based on the same principles as the well-known Dickey-Fuller unit root test. Both its asymptotic behavior and finite sample properties are analyzed, and two empirical applications are provided.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

The branch-site test of positive selection is surprisingly robust but lacks power under synonymous substitution saturation and variation in GC

Positive selection is widely estimated from protein coding sequence alignments by the nonsynonymous-to-synonymous ratio omega. Increasingly elaborate codon models are used in a likelihood framework for this estimation. Although there is widespread concern about the robustness of the estimation of the omega ratio, more efforts are needed to estimate this robustness, especially in the context of complex models. Here, we focused on the branch-site codon model. We investigated its robustness on a large set of simulated data. First, we investigated the impact of sequence divergence. We found evidence of underestimation of the synonymous substitution rate for values as small as 0.5, with a slight increase in false positives for the branch-site test. When dS increases further, underestimation of dS is worse, but false positives decrease. Interestingly, the detection of true positives follows a similar distribution, with a maximum for intermediary values of dS. Thus, high dS is more of a concern for a loss of power (false negatives) than for false positives of the test. Second, we investigated the impact of GC content. We showed that there is no significant difference of false positives between high GC (up to similar to 80%) and low GC (similar to 30%) genes. Moreover, neither shifts of GC content on a specific branch nor major shifts in GC along the gene sequence generate many false positives. Our results confirm that the branch-site is a very conservative test.

DnaSP Version 5. DNA Sequence Polymorphism

DnaSP, DNA Sequence Polymorphism, is a software package for the analysis of nucleotide polymorphism from aligned DNA sequence data. DnaSP can estimate several measures of DNA sequence variation within and between populations (in noncoding, synonymous or nonsynonymous sites, or in various sorts of codon positions), as well as linkage disequilibrium, recombination, gene flow and gene conversion parameters. DnaSP can also carry out several tests of neutrality: Hudson, Kreitman and Aguadé (1987), Tajima (1989), McDonald and Kreitman (1991), Fu and Li (1993), and Fu (1997) tests. Additionally, DnaSP can estimate the confidence intervals of some test-statistics by the coalescent. The results of the analyses are displayed on tabular and graphic form.