995 resultados para Specific loads


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Research work carried out in focusing a novel multiphase-multilevel ac motor drive system much suitable for low-voltage high-current power applications. In specific, six-phase asymmetrical induction motor with open-end stator winding configuration, fed from four standard two-level three-phase voltage source inverters (VSIs). Proposed synchronous reference frame control algorithm shares the total dc source power among the 4 VSIs in each switching cycle with three degree of freedom. Precisely, first degree of freedom concerns with the current sharing between two three-phase stator windings. Based on modified multilevel space vector pulse width modulation shares the voltage between each single VSIs of two three-phase stator windings with second and third degree of freedom, having proper multilevel output waveforms. Complete model of whole ac motor drive based on three-phase space vector decomposition approach was developed in PLECS - numerical simulation software working in MATLAB environment. Proposed synchronous reference control algorithm was framed in MATLAB with modified multilevel space vector pulse width modulator. The effectiveness of the entire ac motor drives system was tested. Simulation results are given in detail to show symmetrical and asymmetrical, power sharing conditions. Furthermore, the three degree of freedom are exploited to investigate fault tolerant capabilities in post-fault conditions. Complete set of simulation results are provided when one, two and three VSIs are faulty. Hardware prototype model of quad-inverter was implemented with two passive three-phase open-winding loads using two TMS320F2812 DSP controllers. Developed McBSP (multi-channel buffered serial port) communication algorithm able to control the four VSIs for PWM communication and synchronization. Open-loop control scheme based on inverse three-phase decomposition approach was developed to control entire quad-inverter configuration and tested with balanced and unbalanced operating conditions with simplified PWM techniques. Both simulation and experimental results are always in good agreement with theoretical developments.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: Although combination antiretroviral therapy (cART) dramatically reduces rates of AIDS and death, a minority of patients experience clinical disease progression during treatment. OBJECTIVE: To investigate whether detection of CXCR4(X4)-specific strains or quantification of X4-specific HIV-1 load predict clinical outcome. METHODS: From the Swiss HIV Cohort Study, 96 participants who initiated cART yet subsequently progressed to AIDS or death were compared with 84 contemporaneous, treated nonprogressors. A sensitive heteroduplex tracking assay was developed to quantify plasma X4 and CCR5 variants and resolve HIV-1 load into coreceptor-specific components. Measurements were analyzed as cofactors of progression in multivariable Cox models adjusted for concurrent CD4 cell count and total viral load, applying inverse probability weights to adjust for sampling bias. RESULTS: Patients with X4 variants at baseline displayed reduced CD4 cell responses compared with those without X4 strains (40 versus 82 cells/microl; P = 0.012). The adjusted multivariable hazard ratio (HR) for clinical progression was 4.8 [95% confidence interval (CI) 2.3-10.0] for those demonstrating X4 strains at baseline. The X4-specific HIV-1 load was a similarly independent predictor, with HR values of 3.7 (95% CI, 1.2-11.3) and 5.9 (95% CI, 2.2-15.0) for baseline loads of 2.2-4.3 and > 4.3 log10 copies/ml, respectively, compared with < 2.2 log10 copies/ml. CONCLUSIONS: HIV-1 coreceptor usage and X4-specific viral loads strongly predicted disease progression during cART, independent of and in addition to CD4 cell count or total viral load. Detection and quantification of X4 strains promise to be clinically useful biomarkers to guide patient management and study HIV-1 pathogenesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Progressive multifocal leukoencephalopathy (PML) is a frequently fatal disease caused by uncontrolled polyomavirus JC (JCV) in severely immunodeficient patients. We investigated the JCV-specific cellular and humoral immunity in the Swiss HIV Cohort Study. We identified PML cases (n = 29), as well as three matched controls per case (n = 87), with prospectively cryopreserved peripheral blood mononuclear cells and plasma at diagnosis. Nested controls were matched according to age, gender, CD4(+) T-cell count, and decline. Survivors (n = 18) were defined as being alive for >1 year after diagnosis. Using gamma interferon enzyme-linked immunospot assays, we found that JCV-specific T-cell responses were lower in nonsurvivors than in their matched controls (P = 0.08), which was highly significant for laboratory- and histologically confirmed PML cases (P = 0.004). No difference was found between PML survivors and controls or for cytomegalovirus-specific T-cell responses. PML survivors showed significant increases in JCV-specific T cells (P = 0.04) and immunoglobulin G (IgG) responses (P = 0.005). IgG responses in survivors were positively correlated with CD4(+) T-cell counts (P = 0.049) and negatively with human immunodeficiency virus RNA loads (P = 0.03). We conclude that PML nonsurvivors had selectively impaired JCV-specific T-cell responses compared to CD4(+) T-cell-matched controls and failed to mount JCV-specific antibody responses. JCV-specific T-cell and IgG responses may serve as prognostic markers for patients at risk.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The spine is routinely subjected to repetitive complex loading consisting of axial compression, torsion, flexion and extension. Mechanical loading is one of the important causes of spinal diseases, including disc herniation and disc degeneration. It is known that static and dynamic compression can lead to progressive disc degeneration, but little is known about the mechanobiology of the disc subjected to combined dynamic compression and torsion. Therefore, the purpose of this study was to compare the mechanobiology of the intervertebral disc when subjected to combined dynamic compression and axial torsion or pure dynamic compression or axial torsion using organ culture. We applied four different loading modalities 1. control: no loading (NL), 2. cyclic compression (CC), 3. cyclic torsion (CT), and 4. combined cyclic compression and torsion (CCT) on bovine caudal disc explants using our custom made dynamic loading bioreactor for disc organ culture. Loads were applied for 8 h/day and continued for 14 days, all at a physiological magnitude and frequency. Our results provided strong evidence that complex loading induced a stronger degree of disc degeneration compared to one degree of freedom loading. In the CCT group, less than 10\% nucleus pulposus (NP) cells survived the 14 days of loading, while cell viabilities were maintained above 70\% in the NP of all the other three groups and in the annulus fibrosus (AF) of all the groups. Gene expression analysis revealed a strong up-regulation in matrix genes and matrix remodeling genes in the AF of the CCT group. Cell apoptotic activity and glycosaminoglycan content were also quantified but there were no statistically significant differences found. Cell morphology in the NP of the CCT was changed, as shown by histological evaluation. Our results stress the importance of complex loading on the initiation and progression of disc degeneration.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bovine besnoitiosis caused by Besnoitia besnoiti is a chronic and debilitating disease. The most characteristic clinical signs of chronic besnoitiosis are visible tissue cysts in the scleral conjunctiva and the vagina, thickened skin and a generally poor body condition. However, many seropositive animals remain subclinically infected, and the role that these animals may play in spreading the disease is not known. The aim of the present study was to assess the intra-organ parasite distribution, the parasite load and the parasite-associated lesions in seropositive but subclinically infected animals. These animals were seropositive at the time of several consecutive samplings, had visible tissue cysts in the past and, at time of slaughter, had detectable specific anti-Besnoitia spp. antibody levels, but they did not show evident clinical signs at culling. Thus, histopathological, immunohistochemical and molecular analyses of several samples from the respiratory tract, reproductive tract, other internal organs and skin from six cows were performed. The tissue cysts were located primarily in the upper respiratory tract, i.e., in the rhinarium and larynx/pharynx (four cows), followed by the distal genital tract (vulva/vagina) and the skin of the neck (three and two cows, respectively, out of the four cows with cysts in the respiratory tract). We were unable to detect any parasites in the two remaining cows. Cysts were associated with a significant non-purulent inflammatory infiltrate consisting predominantly of T lymphocytes and activated monocytes/macrophages in two cows. The parasite burden, estimated by quantitative real-time PCR, was very low. It is noteworthy that the only animal that showed a recent increase in the antibody titre had the highest parasite burden and the most conspicuous inflammatory reaction against the cysts. In conclusion, although these cows no longer displayed any visible signs of besnoitiosis, they remained infected. Therefore, cows without visible signs of disease may still be able to transmit the parasite.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In prospective memory tasks different kinds of load can occur. Adding a prospective memory task can impose a load on ongoing task performance. Adding ongoing task load (OTL) can affect prospective memory performance. The existence of multiple target events increases prospective load (PL) and adding complexity to the to-be-remembered action increases retrospective load (RL). In two experiments, we systematically examined the effects of these different types of load on prospective memory performance. Results showed an effect of PL on costs in the ongoing task for categorical targets (Experiment 2), but not for specific targets (Experiment 1). RL and OTL both affected remembering the retrospective component of the prospective memory task. We suggest that PL can enhance costs in the ongoing task due to additional monitoring requirements. RL and OTL seem to impact the division of resources between the ongoing task and retrieval of the retrospective component, which may affect disengagement from the ongoing task. In general, the results demonstrate that the different types of load affect prospective memory differentially.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Southwestern Africa's coastal marine mudbelt, a prominent Holocene sediment package, provides a valuable archive for reconstructing terrestrial palaeoclimates on the adjacent continent. While the origin of terrestrial inorganic material has been intensively studied, the sources of terrigenous organic material deposited in the mudbelt are yet unclear. In this study, plant wax derived n-alkanes and their compound-specific d13C in soils, flood deposits and suspension loads from regional fluvial systems and marine sediments are analysed to characterize the origin of terrestrial organic material in the southwest African mudbelt. Soils from different biomes in the catchments of the Orange River and small west coast rivers show on average distinct n-alkane distributions and compound-specific d13C values reflecting biome-specific vegetation types, most notably the winter rainfall associated Fynbos Biome of the southwestern Cape. In the fluvial sediment samples from the Orange River, changes in the n-alkane distributions and compound-specific d13C compositions reveal an overprint by local vegetation along the river's course. The smaller west coast rivers show distinct signals, reflecting their small catchment areas and particular vegetation communities. Marine surface sediments spanning a transect from the northern mudbelt (29°S) to St. Helena Bay (33°S) reveal subtle, but spatially coherent, changes in n-alkane distributions and compound-specific d13C, indicating the influence of Orange River sediments in the northern mudbelt, the increasing importance of terrigenous input from the adjacent western coastal biomes in the central mudbelt, and contributions from the Fynbos Biome to the southern mudbelt. These findings indicate the different sources of terrestrial organic material deposited in the mudbelt, and highlight the potential the mudbelt has to preserve evidence of environmental change from the adjacent continent.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The primary aim of this study was to compare rating of perceived exertion (RPE) values measuring repetitions in reserve (RIR) at particular intensities of 1 repetition maximum (RM) in experienced (ES) and novice squatters (NS). Furthermore, this investigation compared average velocity between ES and NS at the same intensities. Twenty-nine individuals (24.0 ± 3.4 years) performed a 1RM squat followed by a single repetition with loads corresponding to 60, 75, and 90% of 1RM and an 8-repetition set at 70% 1RM. Average velocity was recorded at 60, 75, and 90% 1RM and on the first and last repetitions of the 8-repetition set. Subjects reported an RPE value that corresponded to an RIR value (RPE-10 = 0-RIR, RPE-9 = 1-RIR, and so forth). Subjects were assigned to one of the 2 groups: (a) ES (n = 15, training age: 5.2 ± 3.5 years) and (b) NS (n = 14, training age: 0.4 ± 0.6 years). The mean of the average velocities for ES was slower (p ≤ 0.05) than NS at 100% and 90% 1RM. However, there were no differences (p > 0.05) between groups at 60, 75%, or for the first and eighth repetitions at 70% 1RM. In addition, ES recorded greater RPE at 1RM than NS (p = 0.023). In ES, there was a strong inverse relationship between average velocity and RPE at all percentages (r = −0.88, p < 0.001), and a strong inverse correlation in NS between average velocity and RPE at all intensities (r = −0.77, p = 0.001). Our findings demonstrate an inverse relationship between average velocity and RPE/RIR. Experienced squatter group exhibited slower average velocity and higher RPE at 1RM than NS, signaling greater efficiency at high intensities. The RIR-based RPE scale is a practical method to regulate daily training load and provide feedback during a 1RM test.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The increasingly strict regulations on greenhouse gas emissions make the fuel economy a pressing factor for automotive manufacturers. Lightweighting and engine downsizing are two strategies pursued to achieve the target. In this context, materials play a key role since these limit the engine efficiency and components weight, due to their acceptable thermo-mechanical loads. Piston is one of the most stressed engine components and it is traditionally made of Al alloys, whose weakness is to maintain adequate mechanical properties at high temperature due to overaging and softening. The enhancement in strength-to-weight ratio at high temperature of Al alloys had been investigated through two approaches: increase of strength at high temperature or reduction of the alloy density. Several conventional and high performance Al-Si and Al-Cu alloys have been characterized from a microstructural and mechanical point of view, investigating the effects of chemical composition, addition of transition elements and heat treatment optimization, in the specific temperature range for pistons operations. Among the Al-Cu alloys, the research outlines the potentialities of two innovative Al-Cu-Li(-Ag) alloys, typically adopted for structural aerospace components. Moreover, due to the increased probability of abnormal combustions in high performance spark-ignition engines, the second part of the dissertation deals with the study of knocking damages on Al pistons. Thanks to the cooperation with Ferrari S.p.A. and Fluid Machinery Research Group - Unibo, several bench tests have been carried out under controlled knocking conditions. Knocking damage mechanisms were investigated through failure analyses techniques, starting from visual analysis up to detailed SEM investigations. These activities allowed to relate piston knocking damage to engine parameters, with the final aim to develop an on-board knocking controller able to increase engine efficiency, without compromising engine functionality. Finally, attempts have been made to quantify the knock-induced damages, to provide a numerical relation with engine working conditions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This work resumes a wide variety of research activities carried out with the main objective of increasing the efficiency and reducing the fuel consumption of Gasoline Direct Injection engines, especially under high loads. For this purpose, two main innovative technologies have been studied, Water Injection and Low-Pressure Exhaust Gas Recirculation, which help to reduce the temperature of the gases inside the combustion chamber and thus mitigate knock, being this one of the main limiting factors for the efficiency of modern downsized engines that operate at high specific power. A prototypal Port Water Injection system was developed and extensive experimental work has been carried out, initially to identify the benefits and limitations of this technology. This led to the subsequent development and testing of a combustion controller, which has been implemented on a Rapid Control Prototyping environment, capable of managing water injection to achieve knock mitigation and a more efficient combustion phase. Regarding Low-Pressure Exhaust Gas Recirculation, a commercial engine that was already equipped with this technology was used to carry out experimental work in a similar fashion to that of water injection. Another prototypal water injection system has been mounted to this second engine, to be able to test both technologies, at first separately to compare them on equal conditions, and secondly together in the search of a possible synergy. Additionally, based on experimental data from several engines that have been tested during this study, including both GDI and GCI engines, a real-time model (or virtual sensor) for the estimation of the maximum in-cylinder pressure has been developed and validated. This parameter is of vital importance to determine the speed at which damage occurs on the engine components, and therefore to extract the maximum performance without inducing permanent damages.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física