999 resultados para Specific Investments


Relevância:

60.00% 60.00%

Publicador:

Resumo:

A lack of commitment between Japanese buyers and their foreign trading partners is often attributed as the cause of failure for foreign sellers in Japan. Due to Japanese idiosyncrasies, commitment plays a dominant, but poorly understood, role in the business relationship between foreign sellers and Japanese buyers. This research examines the role that the attachment bond between U.S. sellers and Japanese buyers plays in mediating the impact of exchange characteristics on performance in the domestic Japanese market. An analysis of 198 U.S. sellers in Japan demonstrates the complex web of calculative, social, and normative factors that account for the commitment existing in this foreign–Japanese trading relationship. The results highlight the importance of specific investments and cultural sensitivity for the seller’s commitment and the role of trust and switching costs in the buyer’s commitment.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Two key causes of failure for exporters are (1) the availability of adequate resources at the point of entry, and, (2) the quality of the exporter-foreign distributor relationship. Generally, export research has found that, as foreign distributor relationship-specific investments increase and as relational bonds are established, performance improves (e.g., Bello and Gilliland 1997). However, investments and the quality of the relationship are challenged by the foreign distributor’s motivation to participate in the relationship. One way exporters deal with this issue is by developing trade policies, which we refer to as “relational policies,” that are intended to motivate relational behaviors on the part of the foreign distributor.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Power flow calculations are one of the most important tools for power system planning and operation. The need to account for uncertainties when performing power flow studies led, among others methods, to the development of the fuzzy power flow (FPF). This kind of models is especially interesting when a scarcity of information exists, which is a common situation in liberalized power systems (where generation and commercialization of electricity are market activities). In this framework, the symmetric/constrained fuzzy power flow (SFPF/CFPF) was proposed in order to avoid some of the problems of the original FPF model. The SFPF/CFPF models are suitable to quantify the adequacy of transmission network to satisfy “reasonable demands for the transmission of electricity” as defined, for instance, in the European Directive 2009/72/EC. In this work it is illustrated how the SFPF/CFPF may be used to evaluate the impact on the adequacy of a transmission system originated by specific investments on new network elements

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A Work Project, presented as part of the requirements for the Award of a Masters Degree in Management from the NOVA – School of Business and Economics

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A Work Project, presented as part of the requirements for the Award of a Masters Degree in Management from the NOVA – School of Business and Economics

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Previous analysis has shown that traders may opt for specific technologies with nojoint productivity advantage as a way to commit themselves to trading jointly, butonly when long-term contracting is infeasible. This paper proves that speciÞcity canalso be optimal (by relaxing the budget-balance constraint) in settings with long-termcontracting. Traders will opt for specificity when one trader makes a cross-investmentand either (1) this cross-investment has a direct externality on the other trader, (2) bothparties invest, or (3) private information is present. The specificity (e.g. from non-salvageable investments, specific assets and technologies, narrow business strategies,and exclusivity restrictions) is equally effective regardless of which trader's alternativetrade payoff is reduced. Specificity supports long-term contracts in a broad rangeof settings - both with and without renegotiation. The theory also offers a novelperspective on franchising and vertical integration.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The investments have always been considered as an essential backbone and so-called ‘locomotive’ for the competitive economies. However, in various countries, the state has been put under tight budget constraints for the investments in capital intensive projects. In response to this situation, the cooperation between public and private sector has grown based on public-private mechanism. The promotion of favorable arrangement for collaboration between public and private sectors for the provision of policies, services, and infrastructure in Russia can help to address the problems of dry ports development that neither municipalities nor the private sector can solve alone. Especially, the stimulation of public-private collaboration is significant under the exposure to externalities that affect the magnitude of the risks during all phases of project realization. In these circumstances, the risk in the projects also is becoming increasingly a part of joint research and risk management practice, which is viewed as a key approach, aiming to take active actions on existing global and specific factors of uncertainties. Meanwhile, a relatively little progress has been made on the inclusion of the resilience aspects into the planning process of a dry ports construction that would instruct the capacity planner, on how to mitigate the occurrence of disruptions that may lead to million dollars of losses due to the deviation of the future cash flows from the expected financial flows on the project. The current experience shows that the existing methodological base is developed fragmentary within separate steps of supply chain risk management (SCRM) processes: risk identification, risk evaluation, risk mitigation, risk monitoring and control phases. The lack of the systematic approach hinders the solution of the problem of risk management processes of dry port implementation. Therefore, management of various risks during the investments phases of dry port projects still presents a considerable challenge from the practical and theoretical points of view. In this regard, the given research became a logical continuation of fundamental research, existing in the financial models and theories (e.g., capital asset pricing model and real option theory), as well as provided a complementation for the portfolio theory. The goal of the current study is in the design of methods and models for the facilitation of dry port implementation through the mechanism of public-private partnership on the national market that implies the necessity to mitigate, first and foremost, the shortage of the investments and consequences of risks. The problem of the research was formulated on the ground of the identified contradictions. They rose as a continuation of the trade-off between the opportunities that the investors can gain from the development of terminal business in Russia (i.e. dry port implementation) and risks. As a rule, the higher the investment risk, the greater should be their expected return. However, investors have a different tolerance for the risks. That is why it would be advisable to find an optimum investment. In the given study, the optimum relates to the search for the efficient portfolio, which can provide satisfaction to the investor, depending on its degree of risk aversion. There are many theories and methods in finance, concerning investment choices. Nevertheless, the appropriateness and effectiveness of particular methods should be considered with the allowance of the specifics of the investment projects. For example, the investments in dry ports imply not only the lump sum of financial inflows, but also the long-term payback periods. As a result, capital intensity and longevity of their construction determine the necessity from investors to ensure the return on investment (profitability), along with the rapid return on investment (liquidity), without precluding the fact that the stochastic nature of the project environment is hardly described by the formula-based approach. The current theoretical base for the economic appraisals of the dry port projects more often perceives net present value (NPV) as a technique superior to other decision-making criteria. For example, the portfolio theory, which considers different risk preference of an investor and structures of utility, defines net present value as a better criterion of project appraisal than discounted payback period (DPP). Meanwhile, in business practice, the DPP is more popular. Knowing that the NPV is based on the assumptions of certainty of project life, it cannot be an accurate appraisal approach alone to determine whether or not the project should be accepted for the approval in the environment that is not without of uncertainties. In order to reflect the period or the project’s useful life that is exposed to risks due to changes in political, operational, and financial factors, the second capital budgeting criterion – discounted payback period is profoundly important, particularly for the Russian environment. Those statements represent contradictions that exist in the theory and practice of the applied science. Therefore, it would be desirable to relax the assumptions of portfolio theory and regard DPP as not fewer relevant appraisal approach for the assessment of the investment and risk measure. At the same time, the rationality of the use of both project performance criteria depends on the methods and models, with the help of which these appraisal approaches are calculated in feasibility studies. The deterministic methods cannot ensure the required precision of the results, while the stochastic models guarantee the sufficient level of the accuracy and reliability of the obtained results, providing that the risks are properly identified, evaluated, and mitigated. Otherwise, the project performance indicators may not be confirmed during the phase of project realization. For instance, the economic and political instability can result in the undoing of hard-earned gains, leading to the need for the attraction of the additional finances for the project. The sources of the alternative investments, as well as supportive mitigation strategies, can be studied during the initial phases of project development. During this period, the effectiveness of the investments undertakings can also be improved by the inclusion of the various investors, e.g. Russian Railways’ enterprises and other private companies in the dry port projects. However, the evaluation of the effectiveness of the participation of different investors in the project lack the methods and models that would permit doing the particular feasibility study, foreseeing the quantitative characteristics of risks and their mitigation strategies, which can meet the tolerance of the investors to the risks. For this reason, the research proposes a combination of Monte Carlo method, discounted cash flow technique, the theory of real options, and portfolio theory via a system dynamics simulation approach. The use of this methodology allows for comprehensive risk management process of dry port development to cover all aspects of risk identification, risk evaluation, risk mitigation, risk monitoring, and control phases. A designed system dynamics model can be recommended for the decision-makers on the dry port projects that are financed via a public-private partnership. It permits investors to make a decision appraisal based on random variables of net present value and discounted payback period, depending on different risks factors, e.g. revenue risks, land acquisition risks, traffic volume risks, construction hazards, and political risks. In this case, the statistical mean is used for the explication of the expected value of the DPP and NPV; the standard deviation is proposed as a characteristic of risks, while the elasticity coefficient is applied for rating of risks. Additionally, the risk of failure of project investments and guaranteed recoupment of capital investment can be considered with the help of the model. On the whole, the application of these modern methods of simulation creates preconditions for the controlling of the process of dry port development, i.e. making managerial changes and identifying the most stable parameters that contribute to the optimal alternative scenarios of the project realization in the uncertain environment. System dynamics model allows analyzing the interactions in the most complex mechanism of risk management process of the dry ports development and making proposals for the improvement of the effectiveness of the investments via an estimation of different risk management strategies. For the comparison and ranking of these alternatives in their order of preference to the investor, the proposed indicators of the efficiency of the investments, concerning the NPV, DPP, and coefficient of variation, can be used. Thus, rational investors, who averse to taking increased risks unless they are compensated by the commensurate increase in the expected utility of a risky prospect of dry port development, can be guided by the deduced marginal utility of investments. It is computed on the ground of the results from the system dynamics model. In conclusion, the outlined theoretical and practical implications for the management of risks, which are the key characteristics of public-private partnerships, can help analysts and planning managers in budget decision-making, substantially alleviating the effect from various risks and avoiding unnecessary cost overruns in dry port projects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Meese-Rogoff forecasting puzzle states that foreign exchange (FX) rates are unpredictable. Since one country’s macroeconomic conditions could affect the price of its national currency, we study the dynamic relations between the FX rates and some macroeconomic accounts. Our research tests whether the predictability of the FX rates could be improved through the advanced econometrics. Improving the predictability of the FX rates has important implications for various groups including investors, business entities and the government. The present thesis examines the dynamic relations between the FX rates, savings and investments for a sample of 25 countries from the Organization for Economic Cooperation and Development. We apply quarterly data of FX rates, macroeconomic indices and accounts including the savings and the investments over three decades. Through preliminary Augmented Dickey-Fuller unit root tests and Johansen cointegration tests, we found that the savings rate and the investment rate are cointegrated with the vector (1,-1). This result is consistent with many previous studies on the savings-investment relations and therefore confirms the validity of the Feldstein-Horioka puzzle. Because of the special cointegrating relation between the savings rate and investment rate, we introduce the savings-investment rate differential (SID). Investigating each country through a vector autoregression (VAR) model, we observe extremely insignificant coefficient estimates of the historical SIDs upon the present FX rates. We also report similar findings through the panel VAR approach. We thus conclude that the historical SIDs are useless in forecasting the FX rate. Nonetheless, the coefficients of the past FX rates upon the current SIDs for both the country-specific and the panel VAR models are statistically significant. Therefore, we conclude that the historical FX rates can conversely predict the SID to some degree. Specifically, depreciation in the domestic currency would cause the increase in the SID.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Statement of problem. There are few studies on titanium casting shrinkage, and phosphate-bonded investments for titanium casting have not produced appropriate marginal fit.Purpose. The purpose of this study was to determine the thermal shrinkage of titanium and the setting and thermal expansion of 3 phosphate-bonded investments.Material and methods. The thermal shrinkage between the melting temperature and room temperature was calculated using a titanium thermal expansion coefficient. The thermal and setting expansion were measured for 3 phosphate bonded investments: Rematitan Plus (RP) specific for titanium, Rema Exakt (RE), and Castorit Super C (CA), using different special liquid concentrations (100%, 75%, and 50%). Setting expansion was measured for cylindrical specimens 50 mm long x 8 mm in diameter with a transducer. The heating and cooling curves were obtained with a dilatometer (DIL 402 PC). The total expansion curve was drawn using software, and temperatures to obtain expansion equivalent to titanium casting shrinkage were determined (n=5). In addition, the total expansion of the control group (RP at 430 degrees C) was measured, as well as the temperatures at which the other groups achieved equivalent total expansion (n=5). Data were analyzed by 1-way ANOVA and the Tukey HSD test (alpha=.05).Results. Titanium casting shrinkage was estimated as 1.55%. RP did not achieve this expansion. RE achieved expansion of 1.55% only with a special liquid concentration of 100% at 594 degrees C. CA with all special liquid concentrations attained this expansion (351 degrees C to 572 degrees C). Total expansion of the control group was 0.86%, and the other groups reached that expansion within the range of 70 degrees C to 360 degrees C.Conclusions. Only RE and CA demonstrated sufficient expansion to compensate for titanium casting shrinkage. All groups reached total expansion equivalent to that of the control group at significantly lower temperatures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study analyzed the reaction layer and measured the marginal crown fit of cast titanium applied to different phosphate-bonded investments, prepared under the following conditions (liquid concentration/casting temperature): Rema Exakt (RE) - 100%/237°C, 75%/287°C, Castorit Super C (CS)-100%/70°C, 75%/141°C and Rematitan Plus (RP)- 100%/430°C (special to titanium cast, as the control group). The reaction layer was studied using the Vickers hardness test, and analyzed by two way ANOVA and Tukey's HSD tests (α = 0.05). Digital photographs were taken of the crowns seated on the die, the misfit was measured using an image analysis system and One-way ANOVA, and Tukey's test was applied (α = 0.05). The hardness decreased from the surface (601.17 VHN) to 150 μm (204.03 VHN). The group CS 75%/141°C presented higher hardness than the other groups, revealing higher surface contamination, but there were no differences among the groups at measurements deeper than 150 μm. The castings made with CS - 100%/70°C presented the lowest levels of marginal misfit, followed by RE -100%/237°C. The conventional investments CS (100%) and RE (100%) showed better marginal fit than RP, but the CS (75%) had higher surface contamination.