Pure amnesia after unilateral left polar thalamic infarct: topographic and sequential neuropsychological and metabolic (PET) correlations.

A 54-year-old patient who had an isolated small polar thalamic infarct and acute global amnesia with slight frontal type dysfunction but without other neurological dysfunction was studied. Memory improved partially within 8 months. At all stages the impairment was more severe for verbal than non-verbal memory. Autobiographic recollections and newly acquired information tended to be disorganised with respect to temporal order. Procedural memory was unaffected. Both emotional involvement and pleasure in reading were lost. On MRI, the infarct was limited to the left anterior thalamic nuclei and the adjacent mamillothalamic tract. The regional cerebral metabolic rate of glucose (measured with PET) was decreased on the left in the thalamus, amygdala, and posterior cingulate cortex 2 weeks after the infarct, and in the thalamus and posterior cingulate cortex 9 months later. These findings stress the specific role of the left anterior thalamic region in memory and confirm that longlasting amnesia from a thalamic lesion can occur without significant structural damage to the dorsomedial nucleus. Furthermore, they suggest that the anterior thalamic nuclei and possibly their connections with the posterior cingulate cortex play a role in emotional involvement linked to ipsilateral hemispheric functions.

JPEG standard uniform quantization error modeling with applications to sequential and progressive operation modes

In this paper we propose a method for computing JPEG quantization matrices for a given mean square error or PSNR. Then, we employ our method to compute JPEG standard progressive operation mode definition scripts using a quantization approach. Therefore, it is no longer necessary to use a trial and error procedure to obtain a desired PSNR and/or definition script, reducing cost. Firstly, we establish a relationship between a Laplacian source and its uniform quantization error. We apply this model to the coefficients obtained in the discrete cosine transform stage of the JPEG standard. Then, an image may be compressed using the JPEG standard under a global MSE (or PSNR) constraint and a set of local constraints determined by the JPEG standard and visual criteria. Secondly, we study the JPEG standard progressive operation mode from a quantization based approach. A relationship between the measured image quality at a given stage of the coding process and a quantization matrix is found. Thus, the definition script construction problem can be reduced to a quantization problem. Simulations show that our method generates better quantization matrices than the classical method based on scaling the JPEG default quantization matrix. The estimation of PSNR has usually an error smaller than 1 dB. This figure decreases for high PSNR values. Definition scripts may be generated avoiding an excessive number of stages and removing small stages that do not contribute during the decoding process with a noticeable image quality improvement.

Selectivity of glyphosate in tank mixtures for RR soybean in sequential applications with mixtures only in the first or second application

Tank mixtures among herbicides of different action mechanisms might increase weed control spectrum and may be an important strategy for preventing the development of resistance in RR soybean. However, little is known about the effects of these herbicide combinations on soybean plants. Hence, two experiments were carried out aiming at evaluating the selectivity of glyphosate mixtures with other active ingredients applied in postemergence to RR soybean. The first application was carried out at V1 to V2 soybean stage and the second at V3 to V4 (15 days after the first one). For experiment I, treatments (rates in g ha-1) evaluated were composed by two sequential applications: the first one with glyphosate (720) in tank mixtures with cloransulam (30.24), fomesafen (125), lactofen (72), chlorimuron (12.5), flumiclorac (30), bentazon (480) and imazethapyr (80); the second application consisted of isolated glyphosate (480). In experiment II, treatments also consisted of two sequential applications, but tank mixtures as described above were applied as the second application. The first one in this experiment consisted of isolated glyphosate (720). For both experiments, sequential applications of glyphosate alone at 720/480, 960/480, 1200/480 and 960/720 (Expt. I) or 720/480, 720/720, 720/960 and 720/1200 (Expt. II) were used as control treatments. Applications of glyphosate tank mixtures with other herbicides are more selective to RR soybean when applied at younger stages whereas applications at later stages might cause yield losses, especially when glyphosate is mixed with lactofen and bentazon.

A sequential analysis of therapist scaffolding and child concept formation in narrative therapy

Narrative therapy is a postmodern therapy that takes the position that people create self-narratives to make sense of their experiences. To date, narrative therapy has compiled virtually no quantitative and very little qualitative research, leaving gaps in almost all areas of process and outcome. White (2006a), one of the therapy's founders, has recently utilized Vygotsky's (1934/1987) theories of the zone of proximal development (ZPD) and concept formation to describe the process of change in narrative therapy with children. In collaboration with the child client, the narrative therapist formalizes therapeutic concepts and submits them to increasing levels of generalization to create a ZPD. This study sought to determine whether the child's development proceeds through the stages of concept formation over the course of a session, and whether therapists' utterances scaffold this movement. A sequential analysis was used due to its unique ability to measure dynamic processes in social interactions. Stages of concept formation and scaffolding were coded over time. A hierarchical log-linear analysis was performed on the sequential data to develop a model of therapist scaffolding and child concept development. This was intended to determine what patterns occur and whether the stated intent of narrative therapy matches its actual process. In accordance with narrative therapy theory, the log-linear analysis produced a final model with interactions between therapist and child utterances, and between both therapist and child utterances and time. Specifically, the child and youth participants in therapy tended to respond to therapist scaffolding at the corresponding level of concept formation. Both children and youth and therapists also tended to move away from earlier and toward later stages of White's scaffolding conversations map as the therapy session advanced. These findings provide support for White's contention that narrative therapists promote child development by scaffolding child concept formation in therapy.

Point estimates and confidence regions for sequential trials involving selection

A number of authors have proposed clinical trial designs involving the comparison of several experimental treatments with a control treatment in two or more stages. At the end of the first stage, the most promising experimental treatment is selected, and all other experimental treatments are dropped from the trial. Provided it is good enough, the selected experimental treatment is then compared with the control treatment in one or more subsequent stages. The analysis of data from such a trial is problematic because of the treatment selection and the possibility of stopping at interim analyses. These aspects lead to bias in the maximum-likelihood estimate of the advantage of the selected experimental treatment over the control and to inaccurate coverage for the associated confidence interval. In this paper, we evaluate the bias of the maximum-likelihood estimate and propose a bias-adjusted estimate. We also propose an approach to the construction of a confidence region for the vector of advantages of the experimental treatments over the control based on an ordering of the sample space. These regions are shown to have accurate coverage, although they are also shown to be necessarily unbounded. Confidence intervals for the advantage of the selected treatment are obtained from the confidence regions and are shown to have more accurate coverage than the standard confidence interval based upon the maximum-likelihood estimate and its asymptotic standard error.

An adaptive group sequential design for phase II/III clinical trials that select a single treatment from several

There is increasing interest in combining Phases II and III of clinical development into a single trial in which one of a small number of competing experimental treatments is ultimately selected and where a valid comparison is made between this treatment and the control treatment. Such a trial usually proceeds in stages, with the least promising experimental treatments dropped as soon as possible. In this paper we present a highly flexible design that uses adaptive group sequential methodology to monitor an order statistic. By using this approach, it is possible to design a trial which can have any number of stages, begins with any number of experimental treatments, and permits any number of these to continue at any stage. The test statistic used is based upon efficient scores, so the method can be easily applied to binary, ordinal, failure time, or normally distributed outcomes. The method is illustrated with an example, and simulations are conducted to investigate its type I error rate and power under a range of scenarios.

Sequential healing of open extraction sockets. An experimental study in monkeys

AimTo describe the sequential healing of open extraction sockets at which no attempts to obtain a primary closure of the coronal access to the alveolus have been made.Material and methodsThe third mandibular premolar was extracted bilaterally in 12 monkeys, and no sutures were applied to close the wound. The healing after 4, 10, 20, 30, 90 and 180days was morphometrically studied.ResultsAfter 4days of healing, a blood clot mainly occupied the extraction sockets, with the presence of an inflammatory cells' infiltrate. A void was confined in the central zones of the coronal and middle regions, in continuity with the entrance of the alveoli. At 10days, the alveolus was occupied by a provisional matrix, with new bone formation lining the socket bony walls. At 20days, the amount of woven bone was sensibly increasing. At 30days, the alveolar socket was mainly occupied by mineralized immature bone at different stages of healing. At 90 and 180days, the amount of mineralized bone decreased and substituted by trabecular bone and bone marrow. Bundle bone decreased from 95.5% at 4days to 7.6% at 180days, of the whole length of the inner alveolar surface.ConclusionsModeling processes start from the lateral and apical walls of the alveolus, leading to the closure of the socket with newly formed bone within a month from extraction. Remodeling processes will follow the previous stages, resulting in trabecular and bone marrow formation and in a corticalization of the socket access.

Genetic dynamics across early life stages in the tropical tree Prunus africana (Rosaceae)

In many plant species, the genetic template of early life-stages is formed by animal-mediated pollination and seed dispersal and has profound impact on further recruitment and population dynamics. Understanding the impact of pollination and seed dispersal on genetic patterns is a central issue in plant population biology. In my thesis, I investigated (i) contemporary dispersal and gene flow distances as well as (ii) genetic diversity and spatial genetic structure (SGS) across subsequent recruitment stages in a population of the animal-pollinated and dispersed tree Prunus africana in Kakamega Forest, West Kenya. Using microsatellite markers and parentage analyses, I inferred distances of pollen dispersal (father-to-mother), seed dispersal/maternal gene flow (mother-to-offspring) as well as paternal gene flow (father-to-offspring) for four early life stages of the species (seeds and fruits, current year seedlings, seedlings ≤ 3yr, seedlings > 3yr). Distances of pollen and seed dispersal as well as paternal gene flow were significantly shorter than expected from the spatial arrangement of trees and sampling plots. They were not affected by the density of conspecific trees in the surrounding. At the propagule stage, mean pollen dispersal distances were considerably (23-fold) longer than seed dispersal distances, and paternal gene flow distances exceeded maternal gene flow by a factor of 25. Seed dispersal distances were remarkably restricted, potentially leading to a strong initial SGS. The initial genetic template created by pollination and seed dispersal was extensively altered during later recruitment stages. Potential Janzen-Connell effects led to markedly increasing distances between offspring and both parental trees in older life stages. This showed that distance and density-dependent mortality factors are not exclusively related to the mother tree, but also to the father. Across subsequent recruitment stages, the pollen to seed dispersal ratio and the paternal to maternal gene flow ratio dropped to 2.1 and 3.4, respectively, in seedlings > 3yr. The relative changes in effective pollen dispersal, seed dispersal, and paternal gene flow distances across recruitment stages elucidate the mechanisms affecting the contribution of the two processes pollen and seed dispersal to overall gene flow. Using the same six microsatellite loci, I analyzed genetic diversity and SGS across five life stages, from seed rain to adults. Levels of genetic diversity within the studied P. africana population were comparable to other Prunus species and did not vary across life stages. In congruence with the short seed dispersal distances, I found significant SGS in all life stages. SGS decreased from seed and early seedling stages to older juvenile stages, and it was higher in adults than in late juveniles of the next generation. A comparison of the data with direct assessments of contemporary gene flow patterns indicate that distance- or density-dependent mortality, potentially due to Janzen-Connell effects, led to the initial decrease in SGS. Intergeneration variation in SGS could have been driven by variation in demographic processes, the effect of overlapping generations, and local selection processes. Overall, my study showed that complex sequential processes during recruitment contribute to the spatial genetic structure of tree populations. It highlights the importance of a multistage perspective for a comprehensive understanding of the impact of animal-mediated pollen and seed dispersal on spatial population dynamics and genetic patterns of trees.

Bcl-xL (S49) and (S62) sequential phosphorylation/dephosphorylation during mitosis prevents chromosome instability and aneuploidy

Une caractéristique intéressante de la protéine Bcl-xL est la présence d'un domaine en boucle non-structurée entre les hélices α1 and α2 de la protéine. Ce domaine protéique n'est pas essentiel pour sa fonction anti-apoptotique et absent chez CED-9, la protéine orthologue chez Caenorhabditis elegans. A l'intérieur de ce domaine, Bcl-xL subit une phosphorylation et déphosphorylation dynamique sur les résidus Ser49 et Ser62 en phase G2 du cycle cellulaire et lors de la mitose. Lorsque ces résidus sont mutés et les protéines exprimées dans des cellules cancéreuses, les cellules démontrent plusieurs défauts mitotiques liés à l'instabilité chromosomique. Pour analyser les effets de Bcl-xL Ser49 et Ser62 dans les cellules normales, les présentes études ont été réalisées dans des cellules diploïdes humaines normales, et in vivo chez Caenorhabditis elegans. Dans une première étude, nous avons utilisé la lignée cellulaire de cellules fibroblastiques diploïdes humaines normales BJ, exprimant Bcl-xL (type sauvage), (S49A), (S49D), (S62A), (S62D) et les double (S49/62A) et (S49/62D) mutants. Les cellules exprimant les mutants de phosphorylation ont montré des cinétiques de doublement de la population cellulaire réduites. Ces effets sur la cinétique de doublement de la population cellulaire corrèle avec l'apparition de la sénescence cellulaire, sans impact sur les taux de mort cellulaire. Ces cellules sénescentes affichent des phénotypes typiques de sénescence associés notamment à haut niveau de l'activité β-galactosidase associée à la sénescence, la sécrétion d' interleukine-6, l'activation de p53 et de p21WAF1/ Cip1, un inhibiteur des complexes kinase cycline-dépendant, ainsi que la formation de foyers de chromatine nucléaire associés à γH2A.X. Les analyses de fluorescence par hybridation in situ et des caryotypes par coloration au Giemsa ont révélé que l'expression des mutants de phosphorylation de Bcl-xL provoquent de l'instabilité chromosomique et l'aneuploïdie. Ces résultats suggèrent que les cycles de phosphorylation et déphosphorylation dynamiques de Bcl-xL Ser49 et Ser62 sont importants dans le maintien de l'intégrité des chromosomes lors de la mitose dans les cellules normales. Dans une deuxième étude, nous avons entrepris des expériences chez Caenorhabditis elegans pour comprendre l'importance des résidus Ser49 et Ser62 de Bcl-xL in vivo. Les vers transgéniques portant les mutations de Bcl-xL (S49A, S62A, S49D, S62D et S49/62A) ont été générés et leurs effets ont été analysés sur les cellules germinales des jeunes vers adultes. Les vers portant les mutations de Bcl-xL ont montré une diminution de ponte et d'éclosion des oeufs, des variations de la longueur de leurs régions mitotiques et des zones de transition, des anomalies chromosomiques à leur stade de diplotène, et une augmentation de l'apoptose des cellules germinales. Certaines de ces souches transgéniques, en particulier les variants Ser/Ala, ont également montré des variations de durée de vie par rapport aux vers témoins. Ces observations in vivo ont confirmé l'importance de Ser49 et Ser62 à l'intérieur du domaine à boucle de Bcl-xL pour le maintien de la stabilité chromosomique. Ces études auront une incidence sur les futures stratégies visant à développer et à identifier des composés qui pourraient cibler non seulement le domaine anti-apoptotique de la protéine Bcl-xL, mais aussi son domaine mitotique pour la thérapie du cancer.

Energy requirements for the continuous biohydrogen production from Spirogyra biomass in a sequential batch reactor

The current energy market requires urgent revision for the introduction of renewable, less-polluting and inexpensive energy sources. Biohydrogen (bioH2) is considered to be one of the most appropriate options for this model shift, being easily produced through the anaerobic fermentation of carbohydrate-containing biomass. Ideally, the feedstock should be low-cost, widely available and convertible into a product of interest. Microalgae are considered to possess the referred properties, being also highly valued for their capability to assimilate CO2 [1]. The microalga Spirogyra sp. is able to accumulate high concentrations of intracellular starch, a preferential carbon source for some bioH2 producing bacteria such as Clostridium butyricum [2]. In the present work, Spirogyra biomass was submitted to acid hydrolysis to degrade polymeric components and increase the biomass fermentability. Initial tests of bioH2 production in 120 mL reactors with C. butyricum yielded a maximum volumetric productivity of 141 mL H2/L.h and a H2 production yield of 3.78 mol H2/mol consumed sugars. Subsequently, a sequential batch reactor (SBR) was used for the continuous H2 production from Spirogyra hydrolysate. After 3 consecutive batches, the fermentation achieved a maximum volumetric productivity of 324 mL H2/L.h, higher than most results obtained in similar production systems [3] and a potential H2 production yield of 10.4 L H2/L hydrolysate per day. The H2 yield achieved in the SBR was 2.59 mol H2/mol, a value that is comparable to those attained with several thermophilic microorganisms [3], [4]. In the present work, a detailed energy consumption of the microalgae value-chain is presented and compared with previous results from the literature. The specific energy requirements were determined and the functional unit considered was gH2 and MJH2. It was possible to identify the process stages responsible for the highest energy consumption during bioH2 production from Spirogyra biomass for further optimisation.

Bcl-xL (S49) and (S62) sequential phosphorylation/dephosphorylation during mitosis prevents chromosome instability and aneuploidy

Une caractéristique intéressante de la protéine Bcl-xL est la présence d'un domaine en boucle non-structurée entre les hélices α1 and α2 de la protéine. Ce domaine protéique n'est pas essentiel pour sa fonction anti-apoptotique et absent chez CED-9, la protéine orthologue chez Caenorhabditis elegans. A l'intérieur de ce domaine, Bcl-xL subit une phosphorylation et déphosphorylation dynamique sur les résidus Ser49 et Ser62 en phase G2 du cycle cellulaire et lors de la mitose. Lorsque ces résidus sont mutés et les protéines exprimées dans des cellules cancéreuses, les cellules démontrent plusieurs défauts mitotiques liés à l'instabilité chromosomique. Pour analyser les effets de Bcl-xL Ser49 et Ser62 dans les cellules normales, les présentes études ont été réalisées dans des cellules diploïdes humaines normales, et in vivo chez Caenorhabditis elegans. Dans une première étude, nous avons utilisé la lignée cellulaire de cellules fibroblastiques diploïdes humaines normales BJ, exprimant Bcl-xL (type sauvage), (S49A), (S49D), (S62A), (S62D) et les double (S49/62A) et (S49/62D) mutants. Les cellules exprimant les mutants de phosphorylation ont montré des cinétiques de doublement de la population cellulaire réduites. Ces effets sur la cinétique de doublement de la population cellulaire corrèle avec l'apparition de la sénescence cellulaire, sans impact sur les taux de mort cellulaire. Ces cellules sénescentes affichent des phénotypes typiques de sénescence associés notamment à haut niveau de l'activité β-galactosidase associée à la sénescence, la sécrétion d' interleukine-6, l'activation de p53 et de p21WAF1/ Cip1, un inhibiteur des complexes kinase cycline-dépendant, ainsi que la formation de foyers de chromatine nucléaire associés à γH2A.X. Les analyses de fluorescence par hybridation in situ et des caryotypes par coloration au Giemsa ont révélé que l'expression des mutants de phosphorylation de Bcl-xL provoquent de l'instabilité chromosomique et l'aneuploïdie. Ces résultats suggèrent que les cycles de phosphorylation et déphosphorylation dynamiques de Bcl-xL Ser49 et Ser62 sont importants dans le maintien de l'intégrité des chromosomes lors de la mitose dans les cellules normales. Dans une deuxième étude, nous avons entrepris des expériences chez Caenorhabditis elegans pour comprendre l'importance des résidus Ser49 et Ser62 de Bcl-xL in vivo. Les vers transgéniques portant les mutations de Bcl-xL (S49A, S62A, S49D, S62D et S49/62A) ont été générés et leurs effets ont été analysés sur les cellules germinales des jeunes vers adultes. Les vers portant les mutations de Bcl-xL ont montré une diminution de ponte et d'éclosion des oeufs, des variations de la longueur de leurs régions mitotiques et des zones de transition, des anomalies chromosomiques à leur stade de diplotène, et une augmentation de l'apoptose des cellules germinales. Certaines de ces souches transgéniques, en particulier les variants Ser/Ala, ont également montré des variations de durée de vie par rapport aux vers témoins. Ces observations in vivo ont confirmé l'importance de Ser49 et Ser62 à l'intérieur du domaine à boucle de Bcl-xL pour le maintien de la stabilité chromosomique. Ces études auront une incidence sur les futures stratégies visant à développer et à identifier des composés qui pourraient cibler non seulement le domaine anti-apoptotique de la protéine Bcl-xL, mais aussi son domaine mitotique pour la thérapie du cancer.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Isoprenoid biosynthesis in the erythrocytic stages of Plasmodium falciparum

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Analyzing the n→π* Electronic Transition of Formaldehyde in Water. A Sequential Monte Carlo/Time-Dependent Density Functional Theory

The n→π* absorption transition of formaldehyde in water is analyzed using combined and sequential classical Monte Carlo (MC) simulations and quantum mechanics (QM) calculations. MC simulations generate the liquid solute-solvent structures for subsequent QM calculations. Using time-dependent density functional theory in a localized set of gaussian basis functions (TD-DFT/6-311++G(d,p)) calculations are made on statistically relevant configurations to obtain the average solvatochromic shift. All results presented here use the electrostatic embedding of the solvent. The statistically converged average result obtained of 2300 cm-1 is compared to previous theoretical results available. Analysis is made of the effective dipole moment of the hydrogen-bonded shell and how it could be held responsible for the polarization of the solvent molecules in the outer solvation shells.