995 resultados para Seizure Detection
Resumo:
This dissertation established a state-of-the-art programming tool for designing and training artificial neural networks (ANNs) and showed its applicability to brain research. The developed tool, called NeuralStudio, allows users without programming skills to conduct studies based on ANNs in a powerful and very user friendly interface. A series of unique features has been implemented in NeuralStudio, such as ROC analysis, cross-validation, network averaging, topology optimization, and optimization of the activation function’s slopes. It also included a Support Vector Machines module for comparison purposes. Once the tool was fully developed, it was applied to two studies in brain research. In the first study, the goal was to create and train an ANN to detect epileptic seizures from subdural EEG. This analysis involved extracting features from the spectral power in the gamma frequencies. In the second application, a unique method was devised to link EEG recordings to epileptic and non-epileptic subjects. The contribution of this method consisted of developing a descriptor matrix that can be used to represent any EEG file regarding its duration and the number of electrodes. The first study showed that the inter-electrode mean of the spectral power in the gamma frequencies and its duration above a specific threshold performs better than the other frequencies in seizure detection, exhibiting an accuracy of 95.90%, a sensitivity of 92.59%, and a specificity of 96.84%. The second study yielded that Hjorth’s parameter activity is sufficient to accurately relate EEG to epileptic and non-epileptic subjects. After testing, accuracy, sensitivity and specificity of the classifier were all above 0.9667. Statistical tests measured the superiority of activity at over 99.99 % certainty. It was demonstrated that 1) the spectral power in the gamma frequencies is highly effective in locating seizures from EEG and 2) activity can be used to link EEG recordings to epileptic and non-epileptic subjects. These two studies required high computational load and could be addressed thanks to NeuralStudio. From a medical perspective, both methods proved the merits of NeuralStudio in brain research applications. For its outstanding features, NeuralStudio has been recently awarded a patent (US patent No. 7502763).
Resumo:
Brain injury due to lack of oxygen or impaired blood flow around the time of birth, may cause long term neurological dysfunction or death in severe cases. The treatments need to be initiated as soon as possible and tailored according to the nature of the injury to achieve best outcomes. The Electroencephalogram (EEG) currently provides the best insight into neurological activities. However, its interpretation presents formidable challenge for the neurophsiologists. Moreover, such expertise is not widely available particularly around the clock in a typical busy Neonatal Intensive Care Unit (NICU). Therefore, an automated computerized system for detecting and grading the severity of brain injuries could be of great help for medical staff to diagnose and then initiate on-time treatments. In this study, automated systems for detection of neonatal seizures and grading the severity of Hypoxic-Ischemic Encephalopathy (HIE) using EEG and Heart Rate (HR) signals are presented. It is well known that there is a lot of contextual and temporal information present in the EEG and HR signals if examined at longer time scale. The systems developed in the past, exploited this information either at very early stage of the system without any intelligent block or at very later stage where presence of such information is much reduced. This work has particularly focused on the development of a system that can incorporate the contextual information at the middle (classifier) level. This is achieved by using dynamic classifiers that are able to process the sequences of feature vectors rather than only one feature vector at a time.
Resumo:
Sera from 88 patients from Santa Catarina and São Paulo states of Brazil, with epileptic seizures who underwent cerebral computed tomography (CT) were analyzed for the detection of antibodies to T. solium cysticercus by ELISA and Immunoblot (IB) with the following antigens: Taenia solium cysticercus total saline (Tso), Taenia crassiceps cysticercus vesicular fluid (Tcra-vf) and T. crassiceps cysticercus glycoproteins (Tcra-gp). ELISA carried out with Tso, Tcra-vf and Tcra-gp antigens showed 95%, 90% and 80% sensitivities, respectively, and 68%, 85% and 93% specificities, respectively. In the epileptic patients group, ELISA positivity was 30%, 51% and 35% with Tso, Tcra-vf and Tcra-gp antigens respectively. Considering the IB as the confirmatory test, the positivity was 16% (14/88) in the epileptic patients total group and 22% (12/54) in the epileptic patients with positive CT and signals of cysticercosis. We found a significant statistical correlation among ELISA or IB results and the phase of the disease when any antigens were used (p < 0.05). We emphasize the need to introduce in the laboratory routine the search for neurocysticercosis (NC) in patients presenting with epileptic seizures because of the high risk of acquiring NC in our region and its potential cause of epilepsy.
Resumo:
BACKGROUND AND PURPOSE: Perfusion CT (P-CT) is used for acute stroke management, not, however, for evaluating epilepsy. To test the hypothesis that P-CT may identify patients with increased regional cerebral blood flow during subtle status epilepticus (SSE), we compared P-CT in SSE to different postictal conditions. METHODS: Fifteen patients (mean age 47 years, range 21-74) underwent P-CT immediately after evaluation in our emergency room. Asymmetry indices between affected and unaffected hemispheres were calculated for regional cerebral blood volume (rCBV), regional cerebral blood flow (rCBF), and mean transit time (MTT). Regional perfusion changes were compared to EEG findings. RESULTS: Three patients in subtle status epilepticus (group 1) had increased regional perfusion with electro-clinical correlate. Six patients showed postictal slowing on EEG corresponding to an area of regional hypoperfusion (group 2). CT and EEG were normal in six patients with a first epileptic seizure (group 3). Cluster analysis of asymmetry indices separated SSE from the other two groups in all three parameters, while rCBF helped to distinguish between chronic focal epilepsies and single events. CONCLUSION: Preliminary results indicate that P-CT may help to identify patients with SSE during emergency workup. This technique provides important information to neurologists or emergency physicians in the difficult clinical differential diagnosis of altered mental status due to subtle status epilepticus.
Resumo:
The Australian Pregnancy Registry, affiliated European Register of Antiepileptic drugs in Pregnancy (EURAP), recruits informed consenting women with epilepsy on treatment with antiepileptic drugs (AEDs), those untreated, and women on AEDs for other indications. Enrolment is considered prospective if it has occurred before presence or absence of major foetal malformations (FMs) are known, or retrospective, if they had occurred after the birth of infant or detection of major FM. Telephone Interviews are conducted to ascertain pregnancy outcome and collect data about seizures. To date 630 women have been enrolled, with 565 known pregnancy outcomes. Valproate (VPA) above 1100 mg/day was associated with a significantly higher incidence of FMs than other AEDs (P < 0.05). This was independent of other AED use or potentially confounding factors on multivariate analysis (OR = 7.3, P < 0.0001). Lamotrigine (LTG) monotherapy (n = 65), has so far been free of malformations. Although seizure control was not a primary outcome, we noted that more patients on LTG than on VPA required dose adjustments to control seizures. Data indicate an increased risk of FM in women taking VPA in doses > 1100 mg/day compared with other AEDs. The choice of AED for pregnant women with epilepsy requires assessment of balance of risks between teratogenicity and seizure control.
Resumo:
83
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.