Detection of convergent genome-wide signals of adaptation to tropical forests in humans

Tropical forests are believed to be very harsh environments for human life. It is unclear whether human beings would have ever subsisted in those environments without external resources. It is therefore possible that humans have developed recent biological adaptations in response to specific selective pressures to cope with this challenge. To understand such biological adaptations we analyzed genome-wide SNP data under a Bayesian statistics framework, looking for outlier markers with an overly large extent of differentiation between populations living in a tropical forest, as compared to genetically related populations living outside the forest in Africa and the Americas. The most significant positive selection signals were found in genes related to lipid metabolism, the immune system, body development, and RNA Polymerase III transcription initiation. The results are discussed in the light of putative tropical forest selective pressures, namely food scarcity, high prevalence of pathogens, difficulty to move, and inefficient thermoregulation. Agreement between our results and previous studies on the pygmy phenotype, a putative prototype of forest adaptation, were found, suggesting that a few genetic regions previously described as associated with short stature may be evolving under similar positive selection in Africa and the Americas. In general, convergent evolution was less pervasive than local adaptation in one single continent, suggesting that Africans and Amerindians may have followed different routes to adapt to similar environmental selective pressures.

Detection of mitochondrial single nucleotide polymorphisms using a primer elongation reaction on oligonucleotide microarrays

We have developed a novel allele-specific primer elongation protocol using a DNA polymerase on oligonucleotide chips. Oligonucleotide primers carrying polymorphic sites at their free 3́end were covalently bound to glass slides. The generation of single-stranded targets of genomic DNA containing single nuclotide polymorphisms (SNPs) to be typed was achieved by an asymmetric PCR reaction or exonuclease treatment of phosphothioate (PTO)-modified PCR products. In the presence of DNA polymerase and all four dNTPs, with Cy3-dUTP replacing dTTP, allele-specific extension of the immobilized primers took place along a stretch of target DNA sequence. The yield of elongated products was increased by repeated reaction cycles. We performed multiplexed assays with many small DNA targets, or used single targets of up to 4.4 kb mitochondrial DNA (mtDNA) sequence to detect multiple SNPs in one reaction. The latter approach greatly simplifies preamplification of SNP-containing regions, thereby providing a framework for typing hundreds of mtDNA polymorphisms.

Genome-wide copy number variation (CNV) detection in Nelore cattle reveals highly frequent variants in genome regions harboring QTLs affecting production traits.

Background: Copy number variations (CNVs) have been shown to account for substantial portions of observed genomic variation and have been associated with qualitative and quantitative traits and the onset of disease in a number of species. Information from high-resolution studies to detect, characterize and estimate population-specific variant frequencies will facilitate the incorporation of CNVs in genomic studies to identify genes affecting traits of importance. Results: Genome-wide CNVs were detected in high-density single nucleotide polymorphism (SNP) genotyping data from 1,717 Nelore (Bos indicus) cattle, and in NGS data from eight key ancestral bulls. A total of 68,007 and 12,786 distinct CNVs were observed, respectively. Cross-comparisons of results obtained for the eight resequenced animals revealed that 92 % of the CNVs were observed in both datasets, while 62 % of all detected CNVs were observed to overlap with previously validated cattle copy number variant regions (CNVRs). Observed CNVs were used for obtaining breed-specific CNV frequencies and identification of CNVRs, which were subsequently used for gene annotation. A total of 688 of the detected CNVRs were observed to overlap with 286 non-redundant QTLs associated with important production traits in cattle. All of 34 CNVs previously reported to be associated with milk production traits in Holsteins were also observed in Nelore cattle. Comparisons of estimated frequencies of these CNVs in the two breeds revealed 14, 13, 6 and 14 regions in high (>20 %), low (<20 %) and divergent (NEL > HOL, NEL < HOL) frequencies, respectively. Conclusions: Obtained results significantly enriched the bovine CNV map and enabled the identification of variants that are potentially associated with traits under selection in Nelore cattle, particularly in genome regions harboring QTLs affecting production traits.

Genome-wide detection of CNVs and their association with meat tenderness in Nelore cattle.

Brazil is one of the largest beef producers and exporters in the world with the Nelore breed representing the vast majority of Brazilian cattle (Bos taurus indicus). Despite the great adaptability of the Nelore breed to tropical climate, meat tenderness (MT) remains to be improved. Several factors including genetic composition can influence MT. In this article, we report a genome-wide analysis of copy number variation (CNV) inferred from Illumina1 High Density SNP-chip data for a Nelore population of 723 males. We detected >2,600 CNV regions (CNVRs) representing 6.5% of the genome. Comparing our results with previous studies revealed an overlap in 1400 CNVRs (>50%). A total of 1,155 CNVRs (43.6%) overlapped 2,750 genes. They were enriched for processes involving guanosine triphosphate (GTP), previously reported to influence skeletal muscle physiology and morphology. Nelore CNVRs also overlapped QTLs for MT reported in other breeds (8.9%, 236 CNVRs) and from a previous study with this population (4.1%, 109 CNVRs). Two CNVRs were also proximal to glutathione metabolism genes that were previously associated with MT. Genome-wide association study of CN state with estimated breeding values derived from meat shear force identified 6 regions, including a region on BTA3 that contains genes of the cAMP and cGMP pathway. Ten CNVRs that overlapped regions associated with MT were successfully validated by qPCR. Our results represent the first comprehensive CNV study in Bos taurus indicus cattle and identify regions in which copy number changes are potentially of importance for the MT phenotype.

De Novo Assembly And Transcriptome Analysis Of The Rubber Tree (hevea Brasiliensis) And Snp Markers Development For Rubber Biosynthesis Pathways.

Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.