996 resultados para Person detection
Resumo:
[EN]Detecting people is a key capability for robots that operate in populated environments. In this paper, we have adopted a hierarchical approach that combines classifiers created using supervised learning in order to identify whether a person is in the view-scope of the robot or not. Our approach makes use of vision, depth and thermal sensors mounted on top of a mobile platform.
Resumo:
In traffic accidents with pedestrians, cyclists or motorcyclists, patterned impact injuries as well as marks on clothes can be matched to the injury-causing vehicle structure in order to reconstruct the accident and identify the vehicle which has hit the person. Therefore, the differentiation of the primary impact injuries from other injuries is of great importance. Impact injuries can be identified on the external injuries of the skin, the injured subcutaneous and fat tissue, as well as the fractured bones. Another sign of impact is a bone bruise. The bone bruise, or occult bone lesion, means a bleeding in the subcortical bone marrow, which is presumed to be the result of micro-fractures of the medullar trabeculae. The aim of this study was to prove that bleeding in the subcortical bone marrow of the deceased can be detected using the postmortem noninvasive magnetic resonance imaging. This is demonstrated in five accident cases, four involving pedestrians and one a cyclist, where bone bruises were detected in different bones as a sign of impact occurring in the same location as the external and soft tissue impact injuries.
Resumo:
The Quality of Life of a person may depend on early attention to his neurodevel-opment disorders in childhood. Identification of language disorders under the age of six years old can speed up required diagnosis and/or treatment processes. This paper details the enhancement of a Clinical Decision Support System (CDSS) aimed to assist pediatricians and language therapists at early identification and re-ferral of language disorders. The system helps to fine tune the Knowledge Base of Language Delays (KBLD) that was already developed and validated in clinical routine with 146 children. Medical experts supported the construction of Gades CDSS by getting scientific consensus from literature and fifteen years of regis-tered use cases of children with language disorders. The current research focuses on an innovative cooperative model that allows the evolution of the KBLD of Gades through the supervised evaluation of the CDSS learnings with experts¿ feedback. The deployment of the resulting system is being assessed under a mul-tidisciplinary team of seven experts from the fields of speech therapist, neonatol-ogy, pediatrics, and neurology.
Resumo:
The problem of decentralized sequential detection is studied in this thesis, where local sensors are memoryless, receive independent observations, and no feedback from the fusion center. In addition to traditional criteria of detection delay and error probability, we introduce a new constraint: the number of communications between local sensors and the fusion center. This metric is able to reflect both the cost of establishing communication links as well as overall energy consumption over time. A new formulation for communication-efficient decentralized sequential detection is proposed where the overall detection delay is minimized with constraints on both error probabilities and the communication cost. Two types of problems are investigated based on the communication-efficient formulation: decentralized hypothesis testing and decentralized change detection. In the former case, an asymptotically person-by-person optimum detection framework is developed, where the fusion center performs a sequential probability ratio test based on dependent observations. The proposed algorithm utilizes not only reported statistics from local sensors, but also the reporting times. The asymptotically relative efficiency of proposed algorithm with respect to the centralized strategy is expressed in closed form. When the probabilities of false alarm and missed detection are close to one another, a reduced-complexity algorithm is proposed based on a Poisson arrival approximation. In addition, decentralized change detection with a communication cost constraint is also investigated. A person-by-person optimum change detection algorithm is proposed, where transmissions of sensing reports are modeled as a Poisson process. The optimum threshold value is obtained through dynamic programming. An alternative method with a simpler fusion rule is also proposed, where the threshold values in the algorithm are determined by a combination of sequential detection analysis and constrained optimization. In both decentralized hypothesis testing and change detection problems, tradeoffs in parameter choices are investigated through Monte Carlo simulations.
Resumo:
Individuals living in highly networked societies publish a large amount of personal, and potentially sensitive, information online. Web investigators can exploit such information for a variety of purposes, such as in background vetting and fraud detection. However, such investigations require a large number of expensive man hours and human effort. This paper describes InfoScout, a search tool which is intended to reduce the time it takes to identify and gather subject centric information on the Web. InfoScout collects relevance feedback information from the investigator in order to rerank search results, allowing the intended information to be discovered more quickly. Users may still direct their search as they see fit, issuing ad-hoc queries and filtering existing results by keywords. Design choices are informed by prior work and industry collaboration.
Resumo:
Hand detection on images has important applications on person activities recognition. This thesis focuses on PASCAL Visual Object Classes (VOC) system for hand detection. VOC has become a popular system for object detection, based on twenty common objects, and has been released with a successful deformable parts model in VOC2007. A hand detection on an image is made when the system gets a bounding box which overlaps with at least 50% of any ground truth bounding box for a hand on the image. The initial average precision of this detector is around 0.215 compared with a state-of-art of 0.104; however, color and frequency features for detected bounding boxes contain important information for re-scoring, and the average precision can be improved to 0.218 with these features. Results show that these features help on getting higher precision for low recall, even though the average precision is similar.
Resumo:
In the field of educational and psychological measurement, the shift from paper-based to computerized tests has become a prominent trend in recent years. Computerized tests allow for more complex and personalized test administration procedures, like Computerized Adaptive Testing (CAT). CAT, following the Item Response Theory (IRT) models, dynamically generates tests based on test-taker responses, driven by complex statistical algorithms. Even if CAT structures are complex, they are flexible and convenient, but concerns about test security should be addressed. Frequent item administration can lead to item exposure and cheating, necessitating preventive and diagnostic measures. In this thesis a method called "CHeater identification using Interim Person fit Statistic" (CHIPS) is developed, designed to identify and limit cheaters in real-time during test administration. CHIPS utilizes response times (RTs) to calculate an Interim Person fit Statistic (IPS), allowing for on-the-fly intervention using a more secret item bank. Also, a slight modification is proposed to overcome situations with constant speed, called Modified-CHIPS (M-CHIPS). A simulation study assesses CHIPS, highlighting its effectiveness in identifying and controlling cheaters. However, it reveals limitations when cheaters possess all correct answers. The M-CHIPS overcame this limitation. Furthermore, the method has shown not to be influenced by the cheaters’ ability distribution or the level of correlation between ability and speed of test-takers. Finally, the method has demonstrated flexibility for the choice of significance level and the transition from fixed-length tests to variable-length ones. The thesis discusses potential applications, including the suitability of the method for multiple-choice tests, assumptions about RT distribution and level of item pre-knowledge. Also limitations are discussed to explore future developments such as different RT distributions, unusual honest respondent behaviors, and field testing in real-world scenarios. In summary, CHIPS and M-CHIPS offer real-time cheating detection in CAT, enhancing test security and ability estimation while not penalizing test respondents.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.