996 resultados para Obstacle detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Les changements sont faits de façon continue dans le code source des logiciels pour prendre en compte les besoins des clients et corriger les fautes. Les changements continus peuvent conduire aux défauts de code et de conception. Les défauts de conception sont des mauvaises solutions à des problèmes récurrents de conception ou d’implémentation, généralement dans le développement orienté objet. Au cours des activités de compréhension et de changement et en raison du temps d’accès au marché, du manque de compréhension, et de leur expérience, les développeurs ne peuvent pas toujours suivre les normes de conception et les techniques de codage comme les patrons de conception. Par conséquent, ils introduisent des défauts de conception dans leurs systèmes. Dans la littérature, plusieurs auteurs ont fait valoir que les défauts de conception rendent les systèmes orientés objet plus difficile à comprendre, plus sujets aux fautes, et plus difficiles à changer que les systèmes sans les défauts de conception. Pourtant, seulement quelques-uns de ces auteurs ont fait une étude empirique sur l’impact des défauts de conception sur la compréhension et aucun d’entre eux n’a étudié l’impact des défauts de conception sur l’effort des développeurs pour corriger les fautes. Dans cette thèse, nous proposons trois principales contributions. La première contribution est une étude empirique pour apporter des preuves de l’impact des défauts de conception sur la compréhension et le changement. Nous concevons et effectuons deux expériences avec 59 sujets, afin d’évaluer l’impact de la composition de deux occurrences de Blob ou deux occurrences de spaghetti code sur la performance des développeurs effectuant des tâches de compréhension et de changement. Nous mesurons la performance des développeurs en utilisant: (1) l’indice de charge de travail de la NASA pour leurs efforts, (2) le temps qu’ils ont passé dans l’accomplissement de leurs tâches, et (3) les pourcentages de bonnes réponses. Les résultats des deux expériences ont montré que deux occurrences de Blob ou de spaghetti code sont un obstacle significatif pour la performance des développeurs lors de tâches de compréhension et de changement. Les résultats obtenus justifient les recherches antérieures sur la spécification et la détection des défauts de conception. Les équipes de développement de logiciels doivent mettre en garde les développeurs contre le nombre élevé d’occurrences de défauts de conception et recommander des refactorisations à chaque étape du processus de développement pour supprimer ces défauts de conception quand c’est possible. Dans la deuxième contribution, nous étudions la relation entre les défauts de conception et les fautes. Nous étudions l’impact de la présence des défauts de conception sur l’effort nécessaire pour corriger les fautes. Nous mesurons l’effort pour corriger les fautes à l’aide de trois indicateurs: (1) la durée de la période de correction, (2) le nombre de champs et méthodes touchés par la correction des fautes et (3) l’entropie des corrections de fautes dans le code-source. Nous menons une étude empirique avec 12 défauts de conception détectés dans 54 versions de quatre systèmes: ArgoUML, Eclipse, Mylyn, et Rhino. Nos résultats ont montré que la durée de la période de correction est plus longue pour les fautes impliquant des classes avec des défauts de conception. En outre, la correction des fautes dans les classes avec des défauts de conception fait changer plus de fichiers, plus les champs et des méthodes. Nous avons également observé que, après la correction d’une faute, le nombre d’occurrences de défauts de conception dans les classes impliquées dans la correction de la faute diminue. Comprendre l’impact des défauts de conception sur l’effort des développeurs pour corriger les fautes est important afin d’aider les équipes de développement pour mieux évaluer et prévoir l’impact de leurs décisions de conception et donc canaliser leurs efforts pour améliorer la qualité de leurs systèmes. Les équipes de développement doivent contrôler et supprimer les défauts de conception de leurs systèmes car ils sont susceptibles d’augmenter les efforts de changement. La troisième contribution concerne la détection des défauts de conception. Pendant les activités de maintenance, il est important de disposer d’un outil capable de détecter les défauts de conception de façon incrémentale et itérative. Ce processus de détection incrémentale et itérative pourrait réduire les coûts, les efforts et les ressources en permettant aux praticiens d’identifier et de prendre en compte les occurrences de défauts de conception comme ils les trouvent lors de la compréhension et des changements. Les chercheurs ont proposé des approches pour détecter les occurrences de défauts de conception, mais ces approches ont actuellement quatre limites: (1) elles nécessitent une connaissance approfondie des défauts de conception, (2) elles ont une précision et un rappel limités, (3) elles ne sont pas itératives et incrémentales et (4) elles ne peuvent pas être appliquées sur des sous-ensembles de systèmes. Pour surmonter ces limitations, nous introduisons SMURF, une nouvelle approche pour détecter les défauts de conception, basé sur une technique d’apprentissage automatique — machines à vecteur de support — et prenant en compte les retours des praticiens. Grâce à une étude empirique portant sur trois systèmes et quatre défauts de conception, nous avons montré que la précision et le rappel de SMURF sont supérieurs à ceux de DETEX et BDTEX lors de la détection des occurrences de défauts de conception. Nous avons également montré que SMURF peut être appliqué à la fois dans les configurations intra-système et inter-système. Enfin, nous avons montré que la précision et le rappel de SMURF sont améliorés quand on prend en compte les retours des praticiens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We consider reshaping an obstacle virtually by using transformation optics in acoustic and electromagnetic scattering. Among the general virtual reshaping results, the virtual minification and virtual magnification in particular are studied. Stability estimates are derived for scattering amplitude in terms of the diameter of a small obstacle, which implies that the limiting case for minification corresponds to a perfect cloaking, i.e., the obstacle is invisible to detection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Here we determined the analytical sensitivities of broad-range real-time PCR-based assays employing one of three different genomic DNA extraction protocols in combination with one of three different primer pairs targeting the 16S rRNA gene to detect a panel of 22 bacterial species. DNA extraction protocol III, using lysozyme, lysostaphin, and proteinase K, followed by PCR with the primer pair Bak11W/Bak2, giving amplicons of 796 bp in length, showed the best overall sensitivity, detecting DNA of 82% of the strains investigated at concentrations of < or =10(2) CFU in water per reaction. DNA extraction protocols I and II, using less enzyme treatment, combined with other primer pairs giving shorter amplicons of 466 bp and 342 or 346 bp, respectively, were slightly more sensitive for the detection of gram-negative but less sensitive for the detection of gram-positive bacteria. The obstacle of detecting background DNA in blood samples spiked with bacteria was circumvented by introducing a broad-range hybridization probe, and this preserved the minimal detection limits observed in samples devoid of blood. Finally, sequencing of the amplicons generated using the primer pair Bak11W/Bak2 allowed species identification of the detected bacterial DNA. Thus, broad-spectrum PCR targeting the 16S rRNA gene in the quantitative real-time format can achieve an analytical sensitivity of 1 to 10 CFU per reaction in water, avoid detection of background DNA with the introduction of a broad-range probe, and generate amplicons that allow species identification of the detected bacterial DNA by sequencing. These prerequisites are important for its application to blood-containing patient samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to analyze the effects of dual tasking on obstacle crossing during walking by individuals with Alzheimer's disease (AD) and by healthy older people. Thirty four elderly individuals (16 healthy subjects and 18 individuals with AD) were recruited to participate in this study. Three AD individuals and one control participant were excluded due to exclusion criteria. The participants were instructed to walk barefoot at their own speed along an 8 m long pathway. Each participant performed five trials for each condition (unobstructed walking, unobstructed walking with dual tasking, and obstacle crossing during walking with dual tasking). The trials were completely randomized for each participant. The mid-pathway stride was measured in the unobstructed walking trials and the stride that occurred during the obstacle avoidance was measured in the trials that involved obstacle crossing. The behavior of the healthy elderly subjects and individuals with AD was similar for obstacle crossing during walking with dual tasking. Both groups used the posture first strategy to prioritize stability and showed decreased attention to executive tasking while walking. Additionally, AD had a strong influence on the modifications that are made by the elderly while walking under different walking conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.