1000 resultados para Multiuser detection
Resumo:
This paper aims at illustrating some applications of Finite Random Set (FRS) theory to the design and analysis of wireless communication receivers, and at pointing out similarities and differences between this scenario and that pertaining to multi-target tracking, where the use of FRS has been traditionally advocated. Two case studies are considered, l.e., multiuser detection in a dynamic environment, and multicarrier (OFDM) transmission on a frequency-selective channel. Detector designand performance evaluation are discussed, along with the advantages of importing FRS-based estimation techniques to the context of wireless communications.
Resumo:
We study the minimum mean square error (MMSE) and the multiuser efficiency η of large dynamic multiple access communication systems in which optimal multiuser detection is performed at the receiver as the number and the identities of active users is allowed to change at each transmission time. The system dynamics are ruled by a Markov model describing the evolution of the channel occupancy and a large-system analysis is performed when the number of observations grow large. Starting on the equivalent scalar channel and the fixed-point equation tying multiuser efficiency and MMSE, we extend it to the case of a dynamic channel, and derive lower and upper bounds for the MMSE (and, thus, for η as well) holding true in the limit of large signal–to–noise ratios and increasingly large observation time T.
Resumo:
Multi-input multi-output (MIMO) technology is an emerging solution for high data rate wireless communications. We develop soft-decision based equalization techniques for frequency selective MIMO channels in the quest for low-complexity equalizers with BER performance competitive to that of ML sequence detection. We first propose soft decision equalization (SDE), and demonstrate that decision feedback equalization (DFE) based on soft-decisions, expressed via the posterior probabilities associated with feedback symbols, is able to outperform hard-decision DFE, with a low computational cost that is polynomial in the number of symbols to be recovered, and linear in the signal constellation size. Building upon the probabilistic data association (PDA) multiuser detector, we present two new MIMO equalization solutions to handle the distinctive channel memory. With their low complexity, simple implementations, and impressive near-optimum performance offered by iterative soft-decision processing, the proposed SDE methods are attractive candidates to deliver efficient reception solutions to practical high-capacity MIMO systems. Motivated by the need for low-complexity receiver processing, we further present an alternative low-complexity soft-decision equalization approach for frequency selective MIMO communication systems. With the help of iterative processing, two detection and estimation schemes based on second-order statistics are harmoniously put together to yield a two-part receiver structure: local multiuser detection (MUD) using soft-decision Probabilistic Data Association (PDA) detection, and dynamic noise-interference tracking using Kalman filtering. The proposed Kalman-PDA detector performs local MUD within a sub-block of the received data instead of over the entire data set, to reduce the computational load. At the same time, all the inter-ference affecting the local sub-block, including both multiple access and inter-symbol interference, is properly modeled as the state vector of a linear system, and dynamically tracked by Kalman filtering. Two types of Kalman filters are designed, both of which are able to track an finite impulse response (FIR) MIMO channel of any memory length. The overall algorithms enjoy low complexity that is only polynomial in the number of information-bearing bits to be detected, regardless of the data block size. Furthermore, we introduce two optional performance-enhancing techniques: cross- layer automatic repeat request (ARQ) for uncoded systems and code-aided method for coded systems. We take Kalman-PDA as an example, and show via simulations that both techniques can render error performance that is better than Kalman-PDA alone and competitive to sphere decoding. At last, we consider the case that channel state information (CSI) is not perfectly known to the receiver, and present an iterative channel estimation algorithm. Simulations show that the performance of SDE with channel estimation approaches that of SDE with perfect CSI.
Resumo:
In this thesis, we consider four different scenarios of interest in modern satellite communications. For each scenario, we will propose the use of advanced solutions aimed at increasing the spectral efficiency of the communication links. First, we will investigate the optimization of the current standard for digital video broadcasting. We will increase the symbol rate of the signal and determine the optimal signal bandwidth. We will apply the time packing technique and propose a specifically design constellation. We will then compare some receiver architectures with different performance and complexity. The second scenario still addresses broadcast transmissions, but in a network composed of two satellites. We will compare three alternative transceiver strategies, namely, signals completely overlapped in frequency, frequency division multiplexing, and the Alamouti space-time block code, and, for each technique, we will derive theoretical results on the achievable rates. We will also evaluate the performance of said techniques in three different channel models. The third scenario deals with the application of multiuser detection in multibeam satellite systems. We will analyze a case in which the users are near the edge of the coverage area and, hence, they experience a high level of interference from adjacent cells. Also in this case, three different approaches will be compared. A classical approach in which each beam carries information for a user, a cooperative solution based on time division multiplexing, and the Alamouti scheme. The information theoretical analysis will be followed by the study of practical coded schemes. We will show that the theoretical bounds can be approached by a properly designed code or bit mapping. Finally, we will consider an Earth observation scenario, in which data is generated on the satellite and then transmitted to the ground. We will study two channel models, taking into account one or two transmit antennas, and apply techniques such as time and frequency packing, signal predistortion, multiuser detection and the Alamouti scheme.
Resumo:
An efficient Bayesian inference method for problems that can be mapped onto dense graphs is presented. The approach is based on message passing where messages are averaged over a large number of replicated variable systems exposed to the same evidential nodes. An assumption about the symmetry of the solutions is required for carrying out the averages; here we extend the previous derivation based on a replica-symmetric- (RS)-like structure to include a more complex one-step replica-symmetry-breaking-like (1RSB-like) ansatz. To demonstrate the potential of the approach it is employed for studying critical properties of the Ising linear perceptron and for multiuser detection in code division multiple access (CDMA) under different noise models. Results obtained under the RS assumption in the noncritical regime give rise to a highly efficient signal detection algorithm in the context of CDMA; while in the critical regime one observes a first-order transition line that ends in a continuous phase transition point. Finite size effects are also observed. While the 1RSB ansatz is not required for the original problems, it was applied to the CDMA signal detection problem with a more complex noise model that exhibits RSB behavior, resulting in an improvement in performance. © 2007 The American Physical Society.
Resumo:
This work aims at proposing the use of the evolutionary computation methodology in order to jointly solve the multiuser channel estimation (MuChE) and detection problems at its maximum-likelihood, both related to the direct sequence code division multiple access (DS/CDMA). The effectiveness of the proposed heuristic approach is proven by comparing performance and complexity merit figures with that obtained by traditional methods found in literature. Simulation results considering genetic algorithm (GA) applied to multipath, DS/CDMA and MuChE and multi-user detection (MuD) show that the proposed genetic algorithm multi-user channel estimation (GAMuChE) yields a normalized mean square error estimation (nMSE) inferior to 11%, under slowly varying multipath fading channels, large range of Doppler frequencies and medium system load, it exhibits lower complexity when compared to both maximum likelihood multi-user channel estimation (MLMuChE) and gradient descent method (GrdDsc). A near-optimum multi-user detector (MuD) based on the genetic algorithm (GAMuD), also proposed in this work, provides a significant reduction in the computational complexity when compared to the optimum multi-user detector (OMuD). In addition, the complexity of the GAMuChE and GAMuD algorithms were (jointly) analyzed in terms of number of operations necessary to reach the convergence, and compared to other jointly MuChE and MuD strategies. The joint GAMuChE-GAMuD scheme can be regarded as a promising alternative for implementing third-generation (3G) and fourth-generation (4G) wireless systems in the near future. Copyright (C) 2010 John Wiley & Sons, Ltd.
Resumo:
This paper analyzes the convergence behavior of the least mean square (LMS) filter when used in an adaptive code division multiple access (CDMA) detector consisting of a tapped delay line with adjustable tap weights. The sampling rate may be equal to or higher than the chip rate, and these correspond to chip-spaced (CS) and fractionally spaced (FS) detection, respectively. It is shown that CS and FS detectors with the same time-span exhibit identical convergence behavior if the baseband received signal is strictly bandlimited to half the chip rate. Even in the practical case when this condition is not met, deviations from this observation are imperceptible unless the initial tap-weight vector gives an extremely large mean squared error (MSE). This phenomenon is carefully explained with reference to the eigenvalues of the correlation matrix when the input signal is not perfectly bandlimited. The inadequacy of the eigenvalue spread of the tap-input correlation matrix as an indicator of the transient behavior and the influence of the initial tap weight vector on convergence speed are highlighted. Specifically, a initialization within the signal subspace or to the origin leads to very much faster convergence compared with initialization in the a noise subspace.
Resumo:
An analytical framework to analyze the stage-by-stage detection dynamics of the multistage CDMA multiuser detector is presented. The density evolution idea is applied to analyze the multistage detector. Message distribution is treated basically by a Gaussian approximation, but interstage correlation of messages is systematically taken into account, which turns out to provide significant improvement.
Resumo:
We consider the detection of biased information sources in the ubiquitous code-division multiple-access (CDMA) scheme. We propose a simple modification to both the popular single-user matched-filter detector and a recently introduced near-optimal message-passing-based multiuser detector. This modification allows for detecting modulated biased sources directly with no need for source coding. Analytical results and simulations with excellent agreement are provided, demonstrating substantial improvement in bit error rate in comparison with the unmodified detectors and the alternative of source compression. The robustness of error-performance improvement is shown under practical model settings, including bias estimation mismatch and finite-length spreading codes. © 2007 IOP Publishing Ltd.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.