High-resolution, wavelength-division-multiplexed in-fibre Bragg grating sensor system

A novel wavelength-division-multiplexed in-fibre Bragg grating sensor system combined with high resolution drift-compensated interferometric wavelength-shift detection is described. This crosstalk-free system is based on the use of an interferometric wavelength scanner and a low resolution spectrometer. A four element system is demonstrated for temperature measurement, and a resolution of ±0.1°C has been achieved.

A simple, sensitive and selective quantum-dot-based western blot method for the simultaneous detection of multiple targets from cell lysates

Quantum dots (Qdots) are fluorescent nanoparticles that have great potential as detection agents in biological applications. Their optical properties, including photostability and narrow, symmetrical emission bands with large Stokes shifts, and the potential for multiplexing of many different colours, give them significant advantages over traditionally used fluorescent dyes. Here, we report the straightforward generation of stable, covalent quantum dot-protein A/G bioconjugates that will be able to bind to almost any IgG antibody, and therefore can be used in many applications. An additional advantage is that the requirement for a secondary antibody is removed, simplifying experimental design. To demonstrate their use, we show their application in multiplexed western blotting. The sensitivity of Qdot conjugates is found to be superior to fluorescent dyes, and comparable to, or potentially better than, enhanced chemiluminescence. We show a true biological validation using a four-colour multiplexed western blot against a complex cell lysate background, and have significantly improved previously reported non-specific binding of the Qdots to cellular proteins.

High-resolution, wavelength-division-multiplexed in-fibre Bragg grating sensor system

A novel wavelength-division-multiplexed in-fibre Bragg grating sensor system combined with high resolution drift-compensated interferometric wavelength-shift detection is described. This crosstalk-free system is based on the use of an interferometric wavelength scanner and a low resolution spectrometer. A four element system is demonstrated for temperature measurement, and a resolution of ±0.1°C has been achieved.

Resonant cavity time-division-multiplexed fiber Bragg grating sensor interrogator

The first resonant-cavity time-division-multiplexed (TDM) fiber Bragg grating sensor interrogation system is reported. This novel design uses a pulsed semiconductor optical amplifier in a cyclic manner to function as the optical source, amplifier, and modulator. Compatible with a range of standard wavelength detection techniques, this optically gated TDM system allows interrogation of low reflectivity "commodity" sensors spaced just 2 m apart, using a single active component. Results demonstrate an exceptional optical signal-to-noise ratio of 36 dB, a peak signal power of over +7 dBm, and no measurable crosstalk between sensors. Temperature tuning shows that the system is fully stable with a highly linear response. © 2004 IEEE.

Efficient Genotyping of KRAS Mutant Non-Small Cell Lung Cancer Using a Multiplexed Droplet Digital PCR Approach.

Droplet digital PCR (ddPCR) can be used to detect low frequency mutations in oncogene-driven lung cancer. The range of KRAS point mutations observed in NSCLC necessitates a multiplex approach to efficient mutation detection in circulating DNA. Here we report the design and optimisation of three discriminatory ddPCR multiplex assays investigating nine different KRAS mutations using PrimePCR™ ddPCR™ Mutation Assays and the Bio-Rad QX100 system. Together these mutations account for 95% of the nucleotide changes found in KRAS in human cancer. Multiplex reactions were optimised on genomic DNA extracted from KRAS mutant cell lines and tested on DNA extracted from fixed tumour tissue from a cohort of lung cancer patients without prior knowledge of the specific KRAS genotype. The multiplex ddPCR assays had a limit of detection of better than 1 mutant KRAS molecule in 2,000 wild-type KRAS molecules, which compared favourably with a limit of detection of 1 in 50 for next generation sequencing and 1 in 10 for Sanger sequencing. Multiplex ddPCR assays thus provide a highly efficient methodology to identify KRAS mutations in lung adenocarcinoma.

MICROFLUIDIC ASSAY PERFORMANCE ENHANCEMENT USING POROUS VOLUMETRIC DETECTION ELEMENTS FOR IMPEDEMETRIC AND OPTICAL SENSING

Microfluidic technologies have great potential to help create automated, cost-effective, portable devices for rapid point of care (POC) diagnostics in diverse patient settings. Unfortunately commercialization is currently constrained by the materials, reagents, and instrumentation required and detection element performance. While most microfluidic studies utilize planar detection elements, this dissertation demonstrates the utility of porous volumetric detection elements to improve detection sensitivity and reduce assay times. Impedemetric immunoassays were performed utilizing silver enhanced gold nanoparticle immunoconjugates (AuIgGs) and porous polymer monolith or silica bead bed detection elements within a thermoplastic microchannel. For a direct assay with 10 µm spaced electrodes the detection limit was 0.13 fM AuIgG with a 3 log dynamic range. The same assay was performed with electrode spacing of 15, 40, and 100 µm with no significant difference between configurations. For a sandwich assay the detection limit was10 ng/mL with a 4 log dynamic range. While most impedemetric assays rely on expensive high resolution electrodes to enhance planar senor performance, this study demonstrates the employment of porous volumetric detection elements to achieve similar performance using lower resolution electrodes and shorter incubation times. Optical immunoassays were performed using porous volumetric capture elements perfused with refractive index matching solutions to limit light scattering and enhance signal. First, fluorescence signal enhancement was demonstrated with a porous polymer monolith within a silica capillary. Next, transmission enhancement of a direct assay was demonstrated by infusing aqueous sucrose solutions through silica bead beds with captured silver enhanced AuIgGs yielding a detection limit of 0.1 ng/mL and a 5 log dynamic range. Finally, ex situ functionalized porous silica monolith segments were integrated into thermoplastic channels for a reflectance based sandwich assay yielding a detection limit of 1 ng/mL and a 5 log dynamic range. The simple techniques for optical signal enhancement and ex situ element integration enable development of sensitive, multiplexed microfluidic sensors. Collectively the demonstrated experiments validate the use of porous volumetric detection elements to enhance impedemetric and optical microfluidic assays. The techniques rely on commercial reagents, materials compatible with manufacturing, and measurement instrumentation adaptable to POC diagnostics.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.