990 resultados para HUMAN UDP-GALACTOSE-4-EPIMERASE
Resumo:
Morphological features of the mid-palatal suture were studied in human foetuses from 4 to 9 months of intra-uterine life. The foetuses were divided into three age groups, GI (16-23 weeks), GII (24-31 weeks) and GIII (32-39 weeks). The mid-palatal suture in GI foetuses is rectilineal in form with a wide space between the palatal processes of the maxilla. The suture has a sinuous nature in GII and GIII foetuses due to growth of the bone processes crossing the mid-line. A wide zone of cellular proliferation observed in GI narrows in GII and GIII foetuses. The imbricating nature of the suture in GII and GIII is caused by bone growth adjacent to the mid-palatal suture. Sharpey's fibres, emerging from the bone processes, run to the median region of the mid-palatal suture and are observed from GI foetuses onwards. The collagen fibres of the mid-palatal suture are orientated transversely under the oral epithelium and exhibit a regular meshwork with a predominance of sagittal fibres in the median region of the suture. These fibres are orientated transversely and obliquely at the junction with the nasal septum.
Resumo:
Intragenic complementation has been observed at the argininosuccinate lyase (ASL) locus. Intragenic complementation is a phenomenon that occurs when a multimeric protein is formed from subunits produced by different mutant alleles of a gene. The resulting hybrid protein exhibits enzymatic activity that is greater than that found in the oligomeric proteins produced by each mutant allele alone. The mutations involved in the most successful complementation event observed in ASL deficiency were found to be an aspartate to glycine mutation at codon 87 of one allele (D87G) coupled with a glutamine to arginine mutation at codon 286 of the other (Q286R). To understand the structural basis of the Q286R:D87G intragenic complementation event at the ASL locus, we have determined the x-ray crystal structure of recombinant human ASL at 4.0 Å resolution. The structure has been refined to an R factor of 18.8%. Two monomers related by a noncrystallographic 2-fold axis comprise the asymmetric unit, and a crystallographic 2-fold axis of space group P3121 completes the tetramer. Each of the four active sites is composed of residues from three monomers. Structural mapping of the Q286R and D87G mutations indicate that both are near the active site and each is contributed by a different monomer. Thus when mutant monomers combine randomly such that one active site contains both mutations, it is required by molecular symmetry that another active site exists with no mutations. These “native” active sites give rise to the observed partial recovery of enzymatic activity.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The principal aim of this work was to investigate the development of the S-cone colour-opponent pathway in human infants aged 4 weeks to 6 months. This was achieved by recording transient visual evoked responses to pattern-onset stimuli along a tritanopic confusion axis (tritan stimuli) at and around the adult isoluminant match. For comparison, visual evoked responses to red-green and luminance-modulated stimuli were recorded from the same infants at the same ages. Evoked responses were also recorded from colour-normal adults for comparison with those of the infants. The transient VEP allowed observation of response morphology as luminance differences were introduced to the chromatic stimuli. In this way, an estimate of isoluminance was possible in infants. Estimated isoluminant points for a group of six infants aged 6 to 10 weeks closely approximated the adult isoluminant match. This finding has implications for the use of photometric isoluminance in infant work, and suggests that photopic spectral sensitivity is similar in infants and adults. Abnormalities of the visual evoked responses to tritan, red-green and luminance-modulated stimuli in an infant with cystic fibrosis are reported. The results suggest abnormal function of the retino-striate visual pathway in this infant, and it is argued that these may be secondary to his illness, although data from more infants with cystic fibrosis are needed to clarify this further. A group of nine healthy infants demonstrated evoked responses to tritan stimuli by 4 to 10 weeks and to red-green stimuli by 6 to 11 weeks post-term age. Responses to luminance-modulated stimuli were present in all nine infants at the earliest age tested, namely 4 weeks post-term. The slightly earlier age of onset of evoked responses to tritan stimuli than for red-green may be explained by the relatively lower cone contrast afforded by red-green stimuli. Latency of the evoked response to both types of chromatic stimuli and to luminance-modulated stimuli decreased with age at a similar rate, suggesting that the visual pathways transmitting luminance and chromatic information mature at similar rates in young infants.
Resumo:
Astrocytes are essential for neuronal function and survival, so both cell types were included in a human neurotoxicity test-system to assess the protective effects of astrocytes on neurons, compared with a culture of neurons alone. The human NT2.D1 cell line was differentiated to form either a co-culture of post-mitotic NT2.N neuronal (TUJ1, NF68 and NSE positive) and NT2.A astrocytic (GFAP positive) cells (∼2:1 NT2.A:NT2.N), or an NT2.N mono-culture. Cultures were exposed to human toxins, for 4 h at sub-cytotoxic concentrations, in order to compare levels of compromised cell function and thus evidence of an astrocytic protective effect. Functional endpoints examined included assays for cellular energy (ATP) and glutathione (GSH) levels, generation of hydrogen peroxide (H2O2) and caspase-3 activation. Generally, the NT2.N/A co-culture was more resistant to toxicity, maintaining superior ATP and GSH levels and sustaining smaller significant increases in H2O2 levels compared with neurons alone. However, the pure neuronal culture showed a significantly lower level of caspase activation. These data suggest that besides their support for neurons through maintenance of ATP and GSH and control of H2O2 levels, following exposure to some substances, astrocytes may promote an apoptotic mode of cell death. Thus, it appears the use of astrocytes in an in vitro predictive neurotoxicity test-system may be more relevant to human CNS structure and function than neuronal cells alone. © 2007 Elsevier Ltd. All rights reserved.
Resumo:
This article presents a case study of the recent reform of the United Kingdom Equalities and Human Rights Commission, to address a critical gap in the literature on national human rights institutions (NHRIs) concerning the power of governments to exert control over these institutions through reform processes. Through this analysis, the article demonstrates, first, that NHRIs are affected by contextual factors not only related to the popularity of the human rights agenda but also to wider policy agendas which impact on their status and functions; and second, that attempts by government to exert more administrative control can be significantly problematic for the operational independence of NHRIs.
Resumo:
A sensitive and reproducible stir bar-sorptive extraction and high-performance liquid chromatography-UV detection (SBSE/HPLC-UV) method for therapeutic drug monitoring of carbamazepine, carbamazepine-10,11-epoxide, phenytoin and phenobarbital in plasma samples is described and compared with a liquid:liquid extraction (LLE/HPLC-UV) method. Important factors in the optimization of SBSE efficiency such as pH, extraction time and desorption conditions (solvents, mode magnetic stir, mode ultrasonic stir, time and number of steps) assured recoveries ranging from 72 to 86%, except for phenytoin (62%). Separation was obtained using a reverse phase C-18 column with UV detection (210 nm). The mobile phase consisted of water: acetonitrile (78:22, v/v). The SBSE/HPLC-UV method was linear over a working range of 0.08-40.0 mu g mL(-1) for carbamazepine, carbamazepine-10,11-epoxide and phenobarbital and 0.125-40.0 mu g mL(-1) for phenytoin, The intra-assay and inter-assay precision and accuracy were studied at three concentrations (1.0, 4.0 and 20.0 mu g mL(-1)). The intra-assay coefficients of variation (CVs) for all compounds were less than 8.8% and all inter-CVs were less than 10%. Limits of quantification were 0.08 mu g mL(-1) for carbamazepine, carbamazepine-10,11-epoxide and phenobarbital and 0.125 mu g mL(-1) for phenytoin. No interference of the drugs normally associated with antiepileptic drugs was observed. Based on figures of merit results, the SBSE/HPLC-UV proved adequate for antiepileptic drugs analyses from therapeutic levels. This method was successfully applied to the analysis of real samples and was as effective as the LLE/HPLC-UV method. (c) 2008 Elsevier B.V. All rights reserved.
Resumo:
Este estudo tem como objetivos: (1) conhecer as práticas desenvolvidas numa organização do Ensino Superior Público Português; (2) conhecer a tipologia das práticas de GRH de cariz tradicional e de cariz estratégico; (3) perceber em que medida as práticas de GRH estão relacionadas com a área de qualificação dos responsáveis do departamento de RH; (4) averiguar o grau de satisfação que os trabalhadores sentem com as Práticas de Gestão de Recursos Humanos desenvolvidas e a sua relação com a área de qualificação dos responsáveis do departamento de RH. Foi utilizada uma metodologia mista, que possibilita ampliar a obtenção de resultados em abordagens investigativas, proporcionando ganhos relevantes para a pesquisa. É realizado um primeiro estudo exploratório, que utiliza uma metodologia mista quantitativa e qualitativa, com recurso a uma entrevista semiestruturada e inquérito realizados aos responsáveis de RH, e que tem como objetivos identificar e caracterizar as Práticas de GRH vigentes na Organização e, consequentemente, averiguar se se aproximam das designadas na literatura, assim como averiguar o grau de intervenção do DRH no desenvolvimento das PGRH e caraterizar o perfil do responsável de RH na Organização, averiguando se a área de formação de RH influencia as Práticas de GRH desenvolvidas. No segundo estudo, recorremos a uma metodologia quantitativa com recurso ao inquérito por questionário, aplicado aos trabalhadores que exercem funções a tempo integral, para averiguar o grau de satisfação dos trabalhadores em relação às Práticas de Gestão de Recursos Humanos. Na compilação dos dois estudos foi nosso objetivo obter respostas às questões que orientaram a nossa investigação. Na parte final da dissertação são discutidos os principais resultados obtidos e apresentadas as conclusões do estudo aqui levado a cabo. Os resultados sugerem que: 1) as PGRH existentes são essencialmente de cariz tradicional, em especial a gestão administrativa; 2) as PGRH predominantes são: o Planeamento de Recursos Humanos, a Análise e Descrição de Funções, o Recrutamento e Seleção, a Formação e Desenvolvimento, a Gestão Administrativa, a Comunicação e a Partilha de Informação, Ética e Deontologia e o Estatuto Disciplinar; 3) existe pouco recurso ao outsourcing para as PGRH; 4) o grau de intervenção DRH baseia-se em atividades de cariz mais administrativo; 5) as práticas tradicionais de RH são aquelas que requerem mais tempo ao DRH; 6) não existe relação entre o tipo de PGRH e a área de qualificação do responsável do DRH; 7) as PGRH são realizadas seguindo essencialmente as normas legais e regras rígidas da GRH na AP; 8) algumas PGRH não são entendidas em contexto da AP, como importantes pelos gestores, embora já sejam desenvolvidos alguns procedimentos dessas práticas; 9) a PGRH da formação e desenvolvimento não é corretamente desenvolvida e não dá cumprimento ao estipulado na lei; 10) a gestão de carreiras e o sistema de compensação e recompensas são entendidas como inexistentes, porque não existem promoções e progressões desde 2005; 11) a avaliação do desempenho é um sistema burocrático e ritualista com fins de promoção e compensação, sem efeitos práticos no momento atual, e que causa insatisfação e o sentimento de injustiça; 12) existem problemas de comunicação quanto a partilha e uniformização de procedimentos entre UO; 13) a satisfação dos trabalhadores é maior com as PGRH de tipo tradicional, nomeadamente na gestão administrativa, recrutamento e seleção, análise e descrição de funções, acolhimento, integração e socialização 14) a satisfação é menor na gestão de carreiras, no sistema de compensação e recompensas e na avaliação do desempenho; 15) quanto a relação entre o grau de satisfação e as características sócio demográficas e profissionais dos inquiridos, os casos com significância mostram que os trabalhadores com 10 ou mais anos de antiguidade tendem a sentir mais satisfação com as práticas em GRH; 16) existe mais satisfação dos trabalhadores das UO onde o responsável de DRH possui formação na área de RH.
Resumo:
There has been a long-standing debate concerning the extent to which the spread of Neolithic ceramics and Malay-Polynesian languages in Island Southeast Asia (ISEA) were coupled to an agriculturally driven demic dispersal out of Taiwan 4000 years ago (4 ka). We previously addressed this question using founder analysis of mitochondrial DNA (mtDNA) control-region sequences to identify major lineage clusters most likely to have dispersed from Taiwan into ISEA, proposing that the dispersal had a relatively minor impact on the extant genetic structure of ISEA, and that the role of agriculture in the expansion of the Austronesian languages was therefore likely to have been correspondingly minor. Here we test these conclusions by sequencing whole mtDNAs from across Taiwan and ISEA, using their higher chronological precision to resolve the overall proportion that participated in the "out-of-Taiwan" mid-Holocene dispersal as opposed to earlier, postglacial expansions in the Early Holocene. We show that, in total, about 20 % of mtDNA lineages in the modern ISEA pool result from the "out-of-Taiwan" dispersal, with most of the remainder signifying earlier processes, mainly due to sea-level rises after the Last Glacial Maximum. Notably, we show that every one of these founder clusters previously entered Taiwan from China, 6-7 ka, where rice-farming originated, and remained distinct from the indigenous Taiwanese population until after the subsequent dispersal into ISEA.
Resumo:
In this study, 331 samples from calves less than one month old from a dairy herd in the district of Piracanjuba, state of Goiás, Brazil were tested for rotavirus. Thirty-three samples (9.9%) tested positive for rotavirus. Out of those, 31 were submitted to G and P characterization by reverse transcription followed by semi-nested polymerase chain reaction. Two samples were characterized as G6P[1], three as G10P[11] and five as G6P[11]. The majority of the samples (51.6%) displayed multiple P genotypes (P-genotype mixtures), including typical human genotypes P[4] and P[6M], suggesting the occurrence of co-infections and genetic reassortment. Also, the detection of human genotypes in bovine samples may be considered evidence of the zoonotic potential of rotaviruses. To our knowledge, this is the first report of such a high frequency of P genotype mixtures in bovine rotavirus samples. It also increases data on G and P rotavirus genotypes circulating in dairy herds in Brazil and can help in the development of more efficient immunization approaches, thereby controlling infection and reducing economical losses.
Resumo:
We tested sera from 286 agricultural workers and 322 rodents in the department of Córdoba, northeastern Colombia, for antibodies against two hantaviruses. The sera were analysed by indirect ELISA using the lysate of Vero E6 cells infected with Maciel virus (MACV) or the N protein of Araraquara virus (ARAV) as antigens for the detection of antibodies against hantaviruses. Twenty-four human sera were IgG positive using one or both antigens. We detected anti-MACV IgG antibodies in 10 sera (3.5%) and anti-ARAV antibodies in 21 sera (7.34%). Of the 10 samples that were positive for MACV, seven (70%) were cross-reactive with ARAV; seven of the 21 ARAV-positive samples were cross-reactive with MACV. Using an ARAV IgM ELISA, two of the 24 human sera (8.4%) were positive. We captured 322 rodents, including 210 Cricetidae (181 Zygodontomys brevicauda, 28 Oligoryzomys fulvescens and 1 Oecomys trinitatis), six Heteromys anomalus (Heteromyidae), one Proechimys sp. (Echimyidae) and 105 Muridae (34 Rattus rattus and 71 Mus musculus). All rodent sera were negative for both antigens. The 8.4% detection rate of hantavirus antibodies in humans is much higher than previously found in serosurveys in North America, suggesting that rural agricultural workers in northeastern Colombia are frequently exposed to hantaviruses. Our results also indicate that tests conducted with South American hantavirus antigens could have predictive value and could represent a useful alternative for the diagnosis of hantavirus infection in Colombia.
Resumo:
Caspases are best known for their role in apoptosis. More recently, they have gained prominence as critical mediators of innate immune responses. The so-called 'inflammatory caspases' include human caspase-1, -4, -5 and -12 and murine caspase-1, -11 and -12. Of these, caspase-1 is best characterized and serves as the prototype for our understanding of the processing, activation and function of inflammatory caspases. Like their apoptotic counterparts, inflammatory caspases are produced as inactive zymogens and require activation to become proteolytically active. Caspase-1 is activated within the inflammasome, a large cytosolic protein complex that is induced by a growing number of endogenous, microbial, chemical or environmental stimuli. The importance of caspase-1 in initiating innate immune responses is demonstrated by its role in cleaving pro-IL-1 beta and pro-IL-18 to their biologically active forms. New functions have also been implicated, as these proteases and the mechanisms underlying their activation and regulation emerge as important mediators of human health and disease.
Resumo:
With the trend in molecular epidemiology towards both genome-wide association studies and complex modelling, the need for large sample sizes to detect small effects and to allow for the estimation of many parameters within a model continues to increase. Unfortunately, most methods of association analysis have been restricted to either a family-based or a case-control design, resulting in the lack of synthesis of data from multiple studies. Transmission disequilibrium-type methods for detecting linkage disequilibrium from family data were developed as an effective way of preventing the detection of association due to population stratification. Because these methods condition on parental genotype, however, they have precluded the joint analysis of family and case-control data, although methods for case-control data may not protect against population stratification and do not allow for familial correlations. We present here an extension of a family-based association analysis method for continuous traits that will simultaneously test for, and if necessary control for, population stratification. We further extend this method to analyse binary traits (and therefore family and case-control data together) and accurately to estimate genetic effects in the population, even when using an ascertained family sample. Finally, we present the power of this binary extension for both family-only and joint family and case-control data, and demonstrate the accuracy of the association parameter and variance components in an ascertained family sample.
Resumo:
BACKGROUND: Hepatitis E virus (HEV) is the most recently discovered of the hepatotropic viruses, and is considered an emerging pathogen in developed countries with the possibility of fulminant hepatitis in immunocompromised patients. Especially in the latter elevated transaminases should be taken as a clue to consider HEV infection, as it can be treated by discontinuation of immunosuppression and/or ribavirin therapy. To our best knowledge, this is a unique case of autochthonous HEV infection with coincident reactivation of Epstein-Barr virus (EBV) infection in an immunosuppressed patient with rheumatoid arthritis (RA). CASE PRESENTATION: A 68-year-old Swiss woman with RA developed hepatitis initially diagnosed as methotrexate-induced liver injury, but later diagnosed as autochthonous HEV infection accompanied by reactivation of her latent EBV infection. She showed confounding serological results pointing to three hepatotropic viruses (HEV, Hepatitis B virus (HBV) and EBV) that could be resolved by detection of HEV and EBV viraemia. The patient recovered by temporary discontinuation of immunosuppressive therapy. CONCLUSIONS: In immunosuppressed patients with RA and signs of liver injury, HEV infection should be considered, as infection can be treated by discontinuation of immunosuppression. Although anti-HEV-IgM antibody assays can be used as first line virological tools, nucleic acid amplification tests (NAAT) for detection of HEV RNA are recommended--as in our case--if confounding serological results from other hepatotropic viruses are obtained. After discontinuation of immunosuppressive therapy, our patient recovered from both HEV infection and reactivation of latent EBV infection without sequelae.
Resumo:
Retrotransposons, which used to be considered as “junk DNA”, have begun to reveal their immense value to genome evolution and human biology due to recent studies. They consist of at least ~45% of the human genome and are more or less the same in other mammalian genomes. Retrotransposon elements (REs) are known to affect the human genome through many different mechanisms, such as generating insertion mutations, genomic instability, and alteration in gene expression. Previous studies have suggested several RE subfamilies, such as Alu, L1, SVA and LTR, are currently active in the human genome, and they are an important source of genetic diversity between human and other primates, as well as among humans. Although several groups had used Retrotransposon Insertion Polymorphisms (RIPs) as markers in studying primate evolutionary history, no study specifically focused on identifying Human-Specific Retrotransposon Element (HS-RE) and their roles in human genome evolution. In this study, by computationally comparing the human genome to 4 primate genomes, we identified a total of 18,860 HS-REs, among which are 11,664 Alus, 4,887 L1s, 1,526 SVAs and 783 LTRs (222 full length entries), representing the largest and most comprehensive list of HS-REs generated to date. Together, these HS-REs contributed a total of 14.2Mb sequence increase from the inserted REs and Target Site Duplications (TSDs), 71.6Kb increase from transductions, and 268.2 Kb sequence deletion of from insertion-mediated deletion, leading to a net increase of ~14 Mb sequences to the human genome. Furthermore, we observed for the first time that Y chromosome might be a hot target for new retrotransposon insertions in general and particularly for LTRs. The data also allowed for the first time the survey of frequency of TE insertions inside other TEs in comparison with TE insertion into none-TE regions. In summary, our data suggest that retrotransposon elements have played a significant role in the evolution of Homo sapiens.