Crystallization and preliminary X-ray diffraction analysis of recombinant chlorocatechol 1,2-dioxygenase from Pseudomonas putida

Chlorocatechol 1,2-dioxygenase from the Gram-negative bacterium Pseudomonas putida (Pp 1,2-CCD) is considered to be an important biotechnological tool owing to its ability to process a broad spectrum of organic pollutants. In the current work, the crystallization, crystallographic characterization and phasing of the recombinant Pp 1,2-CCD enzyme are described. Reddish-brown crystals were obtained in the presence of polyethylene glycol and magnesium acetate by utilizing the vapour-diffusion technique in sitting drops. Crystal dehydration was the key step in obtaining data sets, which were collected on the D03B-MX2 beamline at the CNPEM/MCT - LNLS using a MAR CCD detector. Pp 1,2-CCD crystals belonged to space group P6(1)22 and the crystallographic structure of Pp 1,2-CCD has been solved by the MR-SAD technique using Fe atoms as scattering centres and the coordinates of 3-chlorocatechol 1,2-dioxygenase from Rhodococcus opacus (PDB entry 2boy) as the search model. The initial model, which contains three molecules in the asymmetric unit, has been refined to 3.4 A resolution.

Quantum-chemical, NMR and X-ray diffraction studies on (+/-)-1-[3,4-(methylenedioxy)phenyl]-2-methylaminopropane

Time-averaged conformations of (+/-)-1-[3,4-(methylenedioxy)phenyl]-2-methylaminopropane hydrochloride (MDMA, ""ecstasy"") in D(2)O, and of its free base and trifluoroacetate in CDCl(3), were deduced from their (1)H NMR spectra and used to calculate their conformer distribution. Their rotational potential energy surface (PES) was calculated at the RHF/6-31G(d,p), 133LYP/6-31G(d,p), B3LYP/cc-pVDZ and AM1 levels. Solvent effects were evaluated using the polarizable continuum model. The NMR and theoretical studies showed that, in the free base, the N-methyl group and the ring are preferentially trans. This preference is stronger in the salts and corresponds to the X-ray structure of the hydrochloride. However, the energy barriers separating these forms are very low. The X-ray diffraction crystal structures of the anhydrous salt and its monohydrate differed mainly in the trans or cis relationship of the N-methyl group to the a-methyl, although these two forms interconvert freely in solution. (C) 2007 Elsevier Inc. All rights reserved.

Analysis of Liquid Crystalline Nanoparticles by Small Angle X-Ray Diffraction: Evaluation of Drug and Pharmaceutical Additives Influence on the Internal Structure

The goal of this work was to study the liquid crystalline structure of a nanodispersion delivery system intended to be used in photodynamic therapy after loading with photosensitizers (PSs) and additives such as preservatives and thickening polymers. Polarized light microscopy and light scattering were performed on a standard nanodispersion in order to determine the anisotropy of the liquid crystalline structure and the mean diameter of the nanoparticles, respectively. Small angle X-ray diffraction (SAXRD) was used to verify the influence of drug loading and additives on the liquid crystalline structure of the nanodispersions. The samples, before and after the addition of PSs and additives, were stable over 90 days, as verified by dynamic light scattering. SAXRD revealed that despite the alteration observed in some of the samples analyzed in the presence of photosensitizing drugs and additives, the hexagonal phase still remained in the crystalline phase. (C) 2011 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 100: 2849-2857, 2011

Crystallization and preliminary X-ray diffraction studies of mammalian purple acid phosphatase

The oxidized form of purple acid phosphatase from pig allantoic fluid has been crystallized in the presence of phosphate using the hanging-drop technique. The crystals belong to the space group P2(1)2(1)2(1) and have unit-cell parameters a = 66.8, b = 70.3, c = 78.7 Angstrom. Diffraction data collected from a cryocooled crystal using a conventional X-ray source extend to 1.55 Angstrom resolution. A knowledge of the three-dimensional structure of mammalian purple acid phosphatase will aid in understanding the substrate specificity of the enzyme and will be important in the rational design of inhibitors, with potential in the treatment of bone diseases.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

Combined experimental powder X-ray diffraction and DFT data to obtain the lowest energy molecular conformation of friedelin

Friedelin molecular conformers were obtained by Density Functional Theory (DFT) and by ab initio structure determination from powder X-ray diffraction. Their conformers with the five rings in chair-chair-chair-boat-boat, and with all rings in chair, are energy degenerated in gas-phase according to DFT results. The powder diffraction data reveals that rings A, B and C of friedelin are in chair, and rings D and E in boat-boat, conformation. The high correlation values among powder diffraction data, DFT and reported single-crystal data indicate that the use of conventional X-ray diffractometer can be applied in routine laboratory analysis in the absence of a single-crystal diffractometer.

X-ray diffraction, thermal analysis, and Raman scattering study of K2BeF4 and comparation to other member of the (beta)-K2SO4 family with ferroelectric -paraelectric transition

Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Peroxidative bromination and oxygenation of organic compounds: synthesis, X-ray crystal structure and catalytic implications of mononuclear and binuclear oxovanadium(V) complexes containing Schiffbase ligands

Treatment of of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) in methanol with aqueous NH(4)VO(3) solution in perchloric acid medium affords the mononuclear oxovanadium(V) complex [VOL(1)(MeOH)]-ClO(4) (1) as deep blue solid while the treatment of same solution of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) with aqueous solution of VOSO(4) leads to the formation of di-(mu-oxo) bridged vanadium(V) complex [VO(2)L(2)](2) (2) as green solid where HL(2) = (R,R)-N-salicylidene cyclohexane 1,2-diamine. The ligand HL(2) is generated in situ by the hydrolysis of one of the imine bonds of HL(1) ligand during the course of formation of complex [VO(2)L(2)](2) (2). Both the compounds have been characterized by single crystal X-ray diffraction as well as spectroscopic methods. Compounds 1 and 2 are to act as catalyst for the catalytic bromide oxidation and C-H bond oxidation in presence of hydrogen peroxide. The representative substrates 2,4-dimethoxy benzoic acid and para-hydroxy benzoic acids are brominated in presence of H(2)O(2) and KBr in acid medium using the above compounds as catalyst. The complexes are also used as catalyst for C-H bond activation of the representative hydrocarbons toluene, ethylbenzene and cyclohexane where hydrogen peroxide acts as terminal oxidant. The yield percentage and turnover number are also quite good for the above catalytic reaction. The oxidized products of hydrocarbons have been characterized by GC Analysis while the brominated products have been characterized by (1)H NMR spectroscopic studies.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

New Ni(II)-sulfonamide complexes: Synthesis, structural characterization and antibacterial properties. X-ray diffraction of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)]

The synthesis, structural characterization, voltammetric experiments and antibacterial activity of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] were studied and compared with similar previously reported copper complexes. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O crystallized in a monoclinic system, space group C2/c where the nickel ion was in a slightly distorted octahedral environment, coordinated with two sulfisoxazole molecules through the heterocyclic nitrogen and four water molecules. [Ni(sulfapyridine)(2)] crystallized in a orthorhombic crystal system, space group Pnab. The nickel ion was in a distorted octahedral environment, coordinated by two aryl amine N from two sulfonamides acting as monodentate ligands and four N atoms (two sulfonamidic N and two heterocyclic N) from two different sulfonamide molecules acting as bidentate ligands. Differential pulse voltammograms were recorded showing irreversible peaks at 1040 and 1070 mV, respectively, attributed to Ni(II)/Ni(III) process. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] presented different antibacterial behavior against Staphylococcus aureus and Escherichia coli from the similar copper complexes and they were inactive against Mycobacterium tuberculosis. (c) 2007 Elsevier Inc. All rights reserved.

Synthesis, Spectroscopic Studies and X-ray Crystal Structures of New Pyrazoline and Pyrazole Derivatives

The synthesis and characterization of some pyrazoline compounds of 1,3-diketones with hydrazine derivatives, namely, 1-(S-benzyldithiocarbazate)-3-methyl-5-phenyl-5-hydroxypyrazoline (1); 1-(2-thiophenecarboxylic)-3-methyl-5-phenyl-5-hydroxypyrazoline (2); 1-(2-thiophenecarboxylic)-3,5-dimethyl-5-hydroxypyrazoline (3); 1-(S-benzyldithiocarbazato)-3-methyl-5-phenylpyrazole (4); 1-(2-thiophenecarboxylic)-3-methyl-5-phenylpyrazole (5) and 1-(S-benzyldithiocarbazate)-3,5-dimethylpyrazole (6) are reported. Studies by IR, ((1)H, (13)C)-NMR spectroscopies and single crystal X-ray diffraction revealed that compounds (1)(,) (2) and (3) are formed as pyrazoline, whereas (4) and (5) are formed as pyrazole derivatives only under acidic conditions. Compound (1) crystallizes in orthorhombic P2(1)2(1)2(1), a = 6.38960(10) angstrom, b = 12.9176(3) angstrom, c = 21.2552(5) angstrom, (2) crystallizes in monoclinic, P2(1)/n, a = 11.3617(2) angstrom, b = 8.4988(2) angstrom, c = 92.8900(10)angstrom and beta = 92.8900(5)degrees, (3) crystallizes in monoclinic, C2/c, a = 15.9500(5) angstrom, b = 9.3766(3) angstrom, c = 16.6910(5)angstrom and beta = 113.825(2)degrees, (4) crystallizes in monoclinic, P2(1)/c, a = 15.228(4) angstrom, b = 5.5714(13) angstrom, c = 19.956(5)angstrom and beta = 91.575(7)degrees and (6) crystallizes in orthorhombic, P2(1)2(1)2(1), a = 5.3920(2) angstrom, b = 11.2074(5) angstrom, c = 21.885(1)angstrom . The (3) derivative represents the first pyrazoline compound prepared from 2,4-pentanedione and characterized crystallographically.