976 resultados para Depression detection
Resumo:
Objective: to determine the ability of the reduced form of a screening instrument, the Patient Health Questionnaire-2 (PHQ-2), to assess the presence of depressive disorders in patients admitted to a general hospital. Method: A sample of 227 patients admitted to the clinical wards of a Brazilian general university hospital were assessed with Module A of the Diagnostic Structured Interview for the DSM-IV (SCID-IV) and filled out the PHQ-9 and PHQ-2. Results: The PHQ-2 demonstrated an area under the ROC curve of 0.89 (p < 0.0001), with a cutoff point of three or more being the one that best equilibrated the sensitivity (0.86) and specificity (0.75) values. The agreement index between the PHQ-2 and module A of SCID-W was 78.4% and the Kappa value was 0.51. Regarding reliability, the Cronbach alpha value obtained was 0.64 and the intraclass correlation coefficient was 0.52. Conclusion: PHQ-2 proved to be an instrument with good psychometric properties comparable to those of PHQ-9, being superior to the latter regarding the rate of false-positive results. In addition, it is a brief instrument that elicits little resistance on the part of the patient, being inexpensive and requiring little time, thus being of important help to the treatment teams for the detection of depressive disorder, being suitable for incorporation into hospital admission protocols and thus possibly favoring more immediate interventions. (Int'l J. Psychiatry in Medicine 2012;44:141-148)
Resumo:
Background: The Beck Depression Inventory (BDI) is used worldwide for detecting depressive symptoms. This questionnaire has been revised (1996) to match the DSM-IV criteria for a major depressive episode. We assessed the reliability and the validity of the Brazilian Portuguese version of the BDI-II for non-clinical adults. Methods: The questionnaire was applied to 60 college students on two occasions. Afterwards, 182 community-dwelling adults completed the BDI-II, the Self-Report Questionnaire, and the K10 Scale. Trained psychiatrists performed face-to-face interviews with the respondents using the Structured Clinical Interview (SCID-I), the Montgomery-angstrom sberg Depression Scale, and the Hamilton Anxiety Scale. Descriptive analysis, signal detection analysis (Receiver Operating Characteristics), correlation analysis, and discriminant function analysis were performed to investigate the psychometric properties of the BDI-II. Results: The intraclass correlation coefficient of the BDI-II was 0.89, and the Cronbach's alpha coefficient of internal consistency was 0.93. Taking the SCID as the gold standard, the cut-off point of 10/11 was the best threshold for detecting depression, yielding a sensitivity of 70% and a specificity of 87%. The concurrent validity (a correlation of 0.63-0.93 with scales applied simultaneously) and the predictive ability of the severity level (over 65% correct classification) were acceptable. Conclusion: The BDI-II is reliable and valid for measuring depressive symptomatology among Portuguese-speaking Brazilian non-clinical populations.
Resumo:
Introduction: Neuroimaging has been widely used in studies to investigate depression in the elderly because it is a noninvasive technique, and it allows the detection of structural and functional brain alterations. Fractional anisotropy (FA) and mean diffusivity (MD) are neuroimaging indexes of the microstructural integrity of white matter, which are measured using diffusion tensor imaging (DTI). The aim of this study was to investigate differences in FA or MD in the entire brain without a previously determined region of interest (ROI) between depressed and non-depressed elderly patients. Method: Brain magnetic resonance imaging scans were obtained from 47 depressed elderly patients, diagnosed according to DSM-IV criteria, and 36 healthy elderly patients as controls. Voxelwise statistical analysis of FA data was performed using tract-based spatial statistics (TBSS). Results: After controlling for age, no significant differences among FA and MD parameters were observed in the depressed elderly patients. No significant correlations were found between cognitive performance and FA or MD parameters. Conclusion: There were no significant differences among FA or MD values between mildly or moderately depressed and non-depressed elderly patients when the brain was analyzed without a previously determined ROI. (C) 2012 Elsevier Ltd. All rights reserved.
Resumo:
Purpose. To evaluate the prevalence of Postpartum Depression (PPD) screening among practicing obstetrician-gynecologists in Texas, and to identify factors and barriers associated with routine depression screening practices.^ Subjects. One hundred and eighty-nine fellows and junior fellows of the Texas Association of Obstetricians & Gynecologists (District XI).^ Methods. A survey questionnaire was developed and sent to 2,028 obstetriciangynecologists, asking about their current screening practices related to PPD. The survey questions were related to the physician's demographics, the patient population, screening practices, barriers to screening, and perceptions about resources in the community. Responses were analyzed to determine associations between these factors and the physician's screening practices. ^ Results. The respondents (n=189) constituted 9.3% of the surveyed population, thus the findings cannot be considered representative of all practicing Ob-Gyns in Texas. However, the following trends were observed. Of the respondents, 85.4% reported routinely screening for PPD, while 14.6% did not. However, of those that screened, only 20.2% used the Edinburgh Postnatal Depression Scale and 7.6% screened with the Postpartum Depression Screening Scale, both validated screening tools. The majority (77.2%) reported using an informal patient interview to screen. For those who did not routinely screen, inadequate training and inadequate resources to screen for PPD were the top two barriers. Physician's age was associated with routine screening practice, as older physicians were less likely to screen routinely. Primary insurance coverage of the patient population was also associated with screening practice; physicians with Medicaid and uninsured patients were less likely to screen routinely. Lastly, physicians that believed that adequate resources existed in their communities for the treatment of PPD were more likely to screen than those that did not.^ Conclusions. The present study is the first attempt at assessing Postpartum Depression screening practices and barriers in Texas. Although the response rate was low, the findings related to informal screening methods and inadequate training indicated that education and training with regards to PPD screening and validated screening tools among Ob-Gyns stand to be improved. Connecting physicians to psychiatric resources may also improve screening rates. This first look at screening practices in Texas serves as a platform for future research in order to gain definitive insight into the diagnosis and treatment of PPD, and ultimately design interventions to improve detection rates and treatment.^
Resumo:
Techniques for improving the signal to clutter ratio of an. ultra-wideband SAR designed to detect small mine-like objects in the surface of the ground were investigated. In particular, images were collected using different bistatic antenna configurations in an attempt to decorrelate the clutter with respect to the targets. The images were converted to a reference depression angle, summed, and then converted to ground coordinates. The resulting target strengths were then compared with the amplitude distribution of the ground clutter to show the improvement obtained. While some improvement was demonstrated, this was for the relatively easy scenario of targets on the surface partially obscured by grass. Detection based on thresholding the raw RF signal (the bipolar response) rather than the envelope (baseband I-2 + Q(2)) was also considered to further enhance target-to-clutter ratios.
Resumo:
Automated perimetry has made viable a rapid threshold examination of the visual field and has reinforced the role of perimetry in the diagnostic procedure. The aim of this study was twofold: to isolate the influence of certain extraneous factors on the sensitivity gradient, since these might limit the early detection and accurate monitoring of visual field loss and to investigate the efficacy of certain novel combinations of stimulus parameters in the detection of early visual field loss. The work was carried out with particular reference to glaucoma and to ocular hypertension. The effects of media opacities on the visual field were assessed by forward intraocular light scatter (n= 15) and were found to mask diffuse glaucomatous visual field loss and underestimate focal loss. Correction of the visual field indices for the effects of forward intraocular light scatter (n= 26) showed the focal losses to be, in reality, unaffected. Measurements of back scatter underestimated forward intraocular light scatter (n= 60) and the resultant depression of the visual field. Perimetric sensitivity improved with patient learning (n= 25) and exhibited eccentricity- and depth-dependency effects whereby improvements in sensitivity were greatest for peripheral areas of the field and for those areas which initially demonstrated the lowest sensitivity. The effects of practice were retained over several months (n= 16). Perimetric sensitivity decreased during prolonged examination due to fatigue effects (n&61 19); these demonstrated a similar eccentricity-dependency, being greatest for eccentricities beyond 30o. Mean sensitivities over the range of adaptation levels employed obeyed the Weber-Fechner law (n= 10) and, as would be expected, were independent of pupil size. No relationship was found between short-term fluctuation and adaptation level. Detection of diffuse glaucomatous visual field loss was facilitated using a size III stimulus of duration 200msec at an adaptation level of 31.5asb, compared with a size III stimulus of duration 100msec at an adaptation level of 4asb (n= 20). In a pilot study (n= 10), temporal summation was found to be higher in glaucomatous patients compared with age-matched controls, although the difference was not statistically significant.
Resumo:
The aim of this work is to empirically generate a shortened version of the Geriatric Depression Scale (GDS), with the intention of maximising the diagnostic performance in the detection of depression compared with previously GDS validated versions, while optimizing the size of the instrument. A total of 233 individuals (128 from a Day Hospital, 105 randomly selected from the community) aged 60 or over completed the GDS and other measures. The 30 GDS items were entered in the Day Hospital sample as independent variables in a stepwise logistic regression analysis predicting diagnosis of Major Depression. A final solution of 10 items was retained, which correctly classified 97.4% of cases. The diagnostic performance of these 10 GDS items was analysed in the random sample with a receiver operating characteristic (ROC) curve. Sensitivity (100%), specificity (97.2%), positive (81.8%) and negative (100%) predictive power, and the area under the curve (0.994) were comparable with values for GDS-30 and higher compared with GDS-15, GDS-10 and GDS-5. In addition, the new scale proposed had excellent fit when testing its unidimensionality with CFA for categorical outcomes (e.g., CFI=0.99). The 10-item version of the GDS proposed here, the GDS-R, seems to retain the diagnostic performance for detecting depression in older adults of the GDS-30 items, while increasing the sensitivity and predictive values relative to other shortened versions.
Resumo:
epidemiological data. It involves a high degree of mortality, namely by suicide, which is the third leading cause of death in the 15-24 age group. Objectives: To assess the presence and severity of depressive symptoms in a non-clinical population of adolescents. Methodology: This is a quantitative, descriptive and cross-sectional study, using the Portuguese version of the Beck Depression Inventory (BDI-II). The sample was composed of 741 adolescents. Results: The results show that 31.2% of the adolescents have depression and, of these, 17.7% have moderate to severe depressive symptoms. Girls have higher levels of depression (p=.00). The total mean score in the BDI-II was 12. Conclusion: Given the adolescents' high vulnerability to depression and suicide, it is essential to implement prevention programs in schools to promote the early detection of depression and suicidal behaviors, and the referral to mental health services.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Objective To assess depression and anxiety symptoms of adolescents with epilepsy compared with adolescents without epilepsy. Method The study sample consisted of: case participants (50 subjects) attending the pediatric epilepsy clinic of a tertiary hospital and control participants (51 subjects) from public schools. The instruments utilized were: identification card with demographic and epilepsy data, Beck Depression Inventory and State-Trait Anxiety Inventory. Results No significant differences were founded between the groups regarding scores for depression and anxiety symptoms but both groups presented moderate scores of anxiety. A correlation was found between low scores anxiety and not frequent seizures, low scores anxiety and perception of seizure control, high scores of anxiety and depression and occurrence of seizures in public places. Conclusion Low scores of anxiety are associated with not frequent seizures; high scores of anxiety and depression are associated with occurrence of seizures in public places.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.