998 resultados para Crack detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Acoustic emission (AE) technique, as one of non-intrusive and nondestructive evaluation techniques, acquires and analyzes the signals emitting from deformation or fracture of materials/structures under service loading. The AE technique has been successfully applied in damage detection in various materials such as metal, alloy, concrete, polymers and other composite materials. In this study, the AE technique was used for detecting crack behavior within concrete specimens under mechanical and environmental frost loadings. The instrumentations of the AE system used in this study include a low-frequency AE sensor, a computer-based data acquisition device and a preamplifier linking the AE sensor and the data acquisition device. The AE system purchased from Mistras Group was used in this study. The AE technique was applied to detect damage with the following laboratory tests: the pencil lead test, the mechanical three-point single-edge notched beam bending (SEB) test, and the freeze-thaw damage test. Firstly, the pencil lead test was conducted to verify the attenuation phenomenon of AE signals through concrete materials. The value of attenuation was also quantified. Also, the obtained signals indicated that this AE system was properly setup to detect damage in concrete. Secondly, the SEB test with lab-prepared concrete beam was conducted by employing Mechanical Testing System (MTS) and AE system. The cumulative AE events and the measured loading curves, which both used the crack-tip open displacement (CTOD) as the horizontal coordinate, were plotted. It was found that the detected AE events were qualitatively correlated with the global force-displacement behavior of the specimen. The Weibull distribution was vii proposed to quantitatively describe the rupture probability density function. The linear regression analysis was conducted to calibrate the Weibull distribution parameters with detected AE signals and to predict the rupture probability as a function of CTOD for the specimen. Finally, the controlled concrete freeze-thaw cyclic tests were designed and the AE technique was planned to investigate the internal frost damage process of concrete specimens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

When drilling ice cores deeper than ∼100 m, drill liquid is required to maintain ice-core quality and to limit borehole closure. Due to high-pressure air bubbles in the ice, the ice core can crack during drilling and core retrieval, typically at 600–1200 m depth in Greenland. Ice from this 'brittle zone' can be contaminated by drill liquid as it seeps through cracks into the core. Continuous flow analysis (CFA) systems are routinely used to analyse ice for chemical impurities, so the detection of drill liquid is important for validating accurate measurements and avoiding potential instrument damage. An optical detector was constructed to identify drill liquid in CFA tubing by ultraviolet absorption spectroscopy at a wavelength of 290 nm. The set-up was successfully field-tested in the frame of the NEEM ice-core drilling project in Greenland. A total of 27 cases of drill liquid contamination were identified during the analysis of 175 m of brittle zone ice. The analyses most strongly affected by drill liquid contamination include insoluble dust particles, electrolytic conductivity, ammonium, hydrogen peroxide and sulphate. This method may also be applied to other types of drill liquid used at other drill sites.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

One of the common failure modes of reinforced concrete (RC) beams strengthened in flexure with a bonded fibre-reinforced polymer (FRP) is intermediate crack (IC) debonding, which is originated at a critical section in the vicinity of flexural cracks and propagates to a plate end. Despite considerable research over the last years, few reliable and simplified IC debonding strength models have been developed. This paper firstly presents a one-dimensional model based on the discrete crack approach for concrete and the spectral element method for the numerical simulation of the IC debonding process. The progressive formation of flexural cracks and subsequent concrete-FRP interfacial debonding is formulated by the introduction of a new element able to represent both phenomena simultaneously without perturbing the numerical procedure. Furthermore, with the proposed model, high frequency dynamic response for these kinds of structures can also be obtained in a very simple and non-expensive way, which makes this procedure very useful as a tool for diagnoses and detection of debonding in its initial stage by monitoring the change in local dynamic characteristics.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper is part of a set of publications related with the development of mathematical models aimed to simulate the dynamic input and output of experimental nondestructive tests in order to detect structural imperfections. The structures to be considered are composed by steel plates of thin thickness. The imperfections in these cases are cracks and they can penetrate either a significant part of the plate thickness or be micro cracks or superficial imperfections. The first class of cracks is related with structural safety and the second one is more connected to the structural protection to the environment, particularly if protective paintings can be deteriorated. Two mathematical groups of models have been developed. The first group tries to locate the position and extension of the imperfection of the first class of imperfections, i.e. cracks and it is the object of the present paper. Bending Kirchoff thin plate models belong to this first group and they are used to this respect. The another group of models is dealt with membrane structures under the superficial Rayleigh waves excitation. With this group of models the micro cracks detection is intended. In the application of the first group of models to the detection of cracks, it has been observed that the differences between the natural frequencies of the non cracked and the cracked structures are very small. However, geometry and crack position can be identified quite accurately if this comparison is carried out between first derivatives (mode rotations) of the natural modes are used instead. Finally, in relation with the analysis of the superficial crack existence the use of Rayleigh waves is very promising. The geometry and the penetration of the micro crack can be detected very accurately. The mathematical and numerical treatment of the generation of these Rayleigh waves present and a numerical application has been shown.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Due to the existence of global modes and local modes of the neighbouring members, damage detection on a structure is more challenging than damage on isolated beams. Detection of an artificial circumferential crack on a joint in a frame-like welded structure is studied in this paper using coupled response measurements. Similarity to real engineering structures is maintained in the fabrication of the test frame. Both the chords and the branch members have hollow sections and the branch members have smaller sizes. The crack is created by a hacksaw on a joint where a branch meets the chord. The methodology is first demonstrated on a single hollow section beam. The test results are then presented for the damaged and undamaged frame. The existence of the damage is clearly observable from the experimental results. It is suggested that this approach offers the-potential to detect damage in welded structures such as cranes, mining equipment, steel-frame bridges, naval and offshore structures. (C) 2003 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.