293 resultados para Conidia.
Resumo:
The objective of this work was to set up ideal conditions for conidia mass production of Dicyma pulvinata. Four isolates were compared in terms of their growth and conidia production on various substrates (grains of parboiled rice, common rice, maize and wheat, besides chipped maize and rice husk), temperatures (19, 22, 25, 28 and 31ºC), growth containers (aluminum trays, polypropylene bags and Erlenmeyers) and light regimes (continuous darkness, 6 and 12 hours of light/darkness, and continuous light). Temperature effects on conidia germination capacity were also evaluated. The experiments were done in randomized complete block designs, in factorial arrangements (isolates x treatments - substrates, containers, temperatures and light regimes), with four replicates. In general, parboiled rice and polypropylene bags provided the best development of the fungus. Complete darkness and 6 hours of light increased mycelial growth, whereas continuous light favored sporulation. All tested temperatures favored the cultures of the fungus, except 31ºC. Temperatures between 19 and 25ºC ensure spore germination of more than 76%.
Resumo:
Oil-based formulated conidia sprayed on steel plates and conidia powder (control) of Beauveria bassiana isolate IMI 386243 were stored at temperatures from 10 to 40 degrees C in desiccators over saturated salt solutions providing relative humidities from 32 to 88%, or in hermetic storage at 40 degrees C, and moisture contents in equilibrium with 33 or 77% relative humidity. The negative semi-logarithmic relation (P < 0.005) between conidia longevity (at 40 degrees C) and equilibrium relative humidity did not differ (P > 0.25) between formulated conidia and conidia powder. Despite this, certain saturated salts provided consistently greater longevity (NaCl) and others consistently shorter longevity (KCl) for formulated conidia compared to conidia powder. These results, analysis of previous data, and comparison with hermetic storage, indicate that storage of conidia over saturated salt solutions provides inconsistent responses to environment and so may be problematic for bio-pesticide research. In hermetic storage, oil formulation was not deleterious to longevity and in the more moist environment enhanced survival periods. (c) 2005 Elsevier Inc. All rights reserved.
Resumo:
The conidia-mycelia transformation is an essential step during the life cycle of the fungal human pathogens of the Pseudallescheria boydii complex. In the present study, we have analyzed the protein and peptidase profiles in two distinct morphological stages, conidia and mycelia, of Scedosporium apiospermum sensu stricto. Proteins synthesized by the mycelia, migrating at the ranges of 62-48 and 22-18 kDa, were not detected from the conidial extract. Conidia produced a single cellular peptidase of 28 kDa able to digest copolymerized albumin, while mycelia yielded 6 distinct peptidases ranging from 90 to 28 kDa. All proteolytic enzymes were active at acidic pH and fully inhibited by 1,10-phenanthroline, characterizing these activities as metallo-type peptidases. Quantitative peptidase assay, using soluble albumin, showed a high metallopeptidase production in mycelial cells in comparison with conidia. The regulated expression of proteins and peptidases in different morphological stages of S. apiospermum represents a potential target for isolation of stage-specific markers for biochemical and immunological analysis.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
O presente trabalho objetivou investigar se meios de cultura utilizados em teste de viabilidade afetam a germinação de conídios de cinco isolados de Lecanicillium lecanii, cinco de Beauveria bassiana e quatro de Paecilomyces fumosoroseus. Os testes foram realizados em lâminas de microscopia contendo um dos seguintes meios de cultura: Ágar-água (AA), Meio Mínimo (MM), Batata, dextrose e ágar (BDA), Batata, dextrose, ágar e 1% de extrato de levedura (BDAL), Sabouraud, dextrose, ágar e extrato de levedura (SDAL) e Meio Completo (MC). Delimitaram-se três áreas por lâmina e em cada uma aplicou-se 0,05mL de uma suspensão com concentração de 5,5 x 105 conídios ml-1. Para cada isolado foi realizado um bioensaio, com seis tratamentos e cinco repetições. Avaliou-se a germinação 15 horas após incubação, a 26±0,5ºC. Os meios de cultura influíram na capacidade de germinação das três espécies estudadas, ocorrendo variações inter e intraespecíficas. Verificou-se que os meios Completo e BDA proporcionaram as maiores porcentagens de germinação dos isolados de L. lecanii, sendo que e as menores foram obtidas nos meios SDAL e AA. Os meios ricos em nutrientes (BDA, BDAL e Completo) favoreceram a germinação dos isolados de B. bassiana, o que não ocorreu com os meios pobres (AA e MM). Nos meios Completo e BDA foram obtidas as maiores porcentagens de germinação dos isolados de P. fumosoroseus. As menores percentagens, por sua vez, foram obtidas no meio SDAL. Entretanto, alguns isolados apresentaram alta germinação em meios pobres em nutrientes (AA e MM).
Resumo:
In this paper, the effect of age, humidity, and temperature on the conidial survival of Entomophthora muscae was evaluated. E. muscae was obtained from Musca domestica in a dairy in Itatiba (São Paulo, Brazil) and maintained in the laboratory by continuous passage through flies. Furthermore, the ability of conidia to infect flies at three temperatures (17, 21, and 27 degrees C), four ages of conidia (12, 72, 96, and 154 hours) and two humidities (100 and 60% RH) was evaluated. The temperature of 21 degrees C was the most favorable for the infection of house flies. Humidity was a cause of variation at 27 degrees C when the conidia were up to 12 hours old, but had no effect at lower temperatures. Conidia held at 100% RH and aged 72 hours caused no infection at 17 degrees C, but were infective at 21 degrees C. In the present study, conidia retained viability much longer than previously observed. Finally, the effect of humidity, temperature, and conidial age is discussed.
Resumo:
Microscopic identification of organic residues in situ on the surface of archaeological artefacts is an established procedure. Where soil components morphologically similar to use-residue types exist within the soil, however, there remains the possibility that these components may be misidentified as authentic residues. The present study investigates common soil components known as conidia, fungal spores which may be mistaken for starch grains. Conidia may exhibit the rotating extinction cross under cross-polarised light commonly diagnostic of starch, and may be morphologically indistinguishable from small starch grains, particularly at the limits of microscope resolution. Conidia were observed on stone and ceramic archaeological artefacts from Honduras, Palau and New Caledonia, as well as experimental artefacts from Papua New Guinea. The findings act as a caution that in situ analysis of residues, and especially of those less than 5 mu m in size, may be subject to misidentification. (c) 2005 Elsevier Ltd. All rights reserved.
Hydrophobicity and surface electrostatic charge of conidia of the mycoparasite Coniothyrium minitans
Resumo:
The effect of increasing culture age on cell surface hydrophobicity (CSH) and cell surface electrostatic charge (measured as zeta potential) of conidia from five isolates of Coniothyrium minitans representing three different morphological types was examined. Conidial CSH of three isolates (A2 960/1, CH1 and CH2) decreased with culture age, whereas CSH of two others (B 1300/2 and IMI 134523) remained high for the whole 42 day experimental period. In contrast, cell surface electrostatic charge decreased uniformly in conidia of all five isolates for the first 34 d and then rose slightly at 42 d. The variation in cell surface electrostatic charge (spectrum width) of the sampled conidia decreased with age for all five isolates. In all five isolates cell surface electrostatic charge of conidia became increasingly negative as the pH of the buffer used to suspend conidia was increased from pH 3.0 to 9.0. No relationship between colony morphology of C. minitans and conidial CSH and cell surface electrostatic charge was found.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Background: We have previously explored a therapeutic strategy for specifically targeting the profibrotic activity of IL-13 during experimental pulmonary fibrosis using a fusion protein comprised of human IL-13 and a mutated form of Pseudomonas aeruginosa exotoxin A (IL13-PE) and observed that the intranasal delivery of IL13-PE reduced bleomycin-induced pulmonary fibrosis through its elimination of IL-13-responsive cells in the lung. The aim of the present study was to determine whether the presence of an immune response to P. aeruginosa and/or its exotoxin A (PE) would diminish the anti-fibrotic properties of IL13-PE. Methodology/Principal Findings: Fourteen days after P. aeruginosa infection, C57BL/6 mice were injected with bleomycin via the intratracheal route. Other groups of mice received 4 doses of saline or IL13-PE by either intranasal or intraperitoneal application, and were challenged i.t. with bleomycin 28 days later. At day 21 after bleomycin, all mice received either saline vehicle or IL13-PE by the intranasal route and histopatological analyses of whole lung samples were performed at day 28 after bleomycin. Intrapulmonary P. aeruginosa infection promoted a neutralizing IgG2A and IgA antibody response in BALF and serum. Surprisingly, histological analysis showed that a prior P. aeruginosa infection attenuated the development of bleomycin-induced pulmonary fibrosis, which was modestly further attenuated by the intranasal administration of IL13-PE. Although prior intranasal administration of IL13-PE failed to elicit an antibody response, the systemic administration of IL13-PE induced a strong neutralizing antibody response. However, the prior systemic sensitization of mice with IL13-PE did not inhibit the anti-fibrotic effect of IL13-PE in fibrotic mice. Conclusions: Thus, IL13-PE therapy in pulmonary fibrosis works regardless of the presence of a humoral immune response to Pseudomonas exotoxin A. Interestingly, a prior infection with P. aeruginosa markedly attenuated the pulmonary fibrotic response suggesting that the immune elicitation by this pathogen exerts anti-fibrotic effects.
Resumo:
Background: Identifying clusters of acute paracoccidioidomycosis cases could potentially help in identifying the environmental factors that influence the incidence of this mycosis. However, unlike other endemic mycoses, there are no published reports of clusters of paracoccidioidomycosis. Methodology/Principal Findings: A retrospective cluster detection test was applied to verify if an excess of acute form (AF) paracoccidioidomycosis cases in time and/or space occurred in Botucatu, an endemic area in Sao Paulo State. The scan-test SaTScan v7.0.3 was set to find clusters for the maximum temporal period of 1 year. The temporal test indicated a significant cluster in 1985 (P<0.005). This cluster comprised 10 cases, although 2.19 were expected for this year in this area. Age and clinical presentation of these cases were typical of AF paracccidioidomycosis. The space-time test confirmed the temporal cluster in 1985 and showed the localities where the risk was higher in that year. The cluster suggests that some particularities took place in the antecedent years in those localities. Analysis of climate variables showed that soil water storage was atypically high in 1982/83 (similar to 2.11/2.5 SD above mean), and the absolute air humidity in 1984, the year preceding the cluster, was much higher than normal (similar to 1.6 SD above mean), conditions that may have favored, respectively, antecedent fungal growth in the soil and conidia liberation in 1984, the probable year of exposure. These climatic anomalies in this area was due to the 1982/83 El Nino event, the strongest in the last 50 years. Conclusions/Significance: We describe the first cluster of AF paracoccidioidomycosis, which was potentially linked to a climatic anomaly caused by the 1982/83 El Nino Southern Oscillation. This finding is important because it may help to clarify the conditions that favor Paracoccidioides brasiliensis survival and growth in the environment and that enhance human exposure, thus allowing the development of preventive measures.
Resumo:
Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.