1000 resultados para APPRESSORIUM FORMATION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to evaluate the effects of a flavor-containing dentifrice on the formation of volatile sulphur compounds (VSCs) in morning bad breath. A two-step, blinded, crossover, randomized study was carried out in 50 dental students with a healthy periodontium divided into two experimental groups: flavor-containing dentifrice (test) and non-flavor-containing dentifrice (control). The volunteers received the designated dentifrice and a new toothbrush for a 3 X/day brushing regimen for 2 periods of 30 days. A seven-day washout interval was used between the periods. The assessed parameters were: plaque index (PI), gingival index (GI), organoleptic breath scores (ORG), VSC levels (as measured by a portable sulphide monitor) before (H1) and after (H2) cleaning of the tongue, tongue coating (TC) wet weight and BANA test from TC samples. The intra-group analysis showed a decrease in ORG, from 3 to 2, after 30 days for the test group (p < 0.05). The inter-group analysis showed lower values in ORG, H1 and H2 for the test group (p < 0.05). There was no difference between the amount of TC between groups and the presence of flavor also did not interfere in the BANA results between groups (p > 0.05). These findings suggest that a flavor-containing dentifrice seems to prevent VSCs formation in morning bad breath regardless of the amount of TC in periodontally healthy subjects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: Dental fusion is defined as the union of two dental germs at some stage of their development. The aim of this article is to report the endodontic treatment of two clinical cases of dental fusion. CASE DESCRIPTION: In the first case, the patient was referred by an orthodontist for endodontic treatment of tooth 12, which was fused to 13. Surgical separation and later replacement of the involved elements in the dental arch was indicated. In the second case, the patient sought dental attendance due to spontaneous pain. In the radiographic exam, gemination in tooth 11 and fusion of 21 with a supernumerary tooth was observed. The fused teeth were endodontically treated, and patients were referred to other dental specialties to reestablish esthetics and function. CONCLUSION: The dentist must be able to diagnose, differentiate and treat these dental anomalies adequately, with the goal of maintaining patients' oral health.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, sedimentary organic matter of oil shale rejects, calschist, shale fine and the so called retorted shale from Irati formation was characterized. EPR was used to analyse the samples regarding loss of signal in g = 2.003 associated to the organic free radical with the calcined samples and washing with hydrogen peroxide. The radical signal was detected in all samples, however, for the calschist and shale fine samples another signal was identified at g = 2.000 which disappeared when the sample was heated at 400 ºC. Hydrogen peroxide washing was also performed and it was noted that after washing the signal appeared around g = 2.000 for all samples, including retorted shale, which might be due to the quartz E1 defect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tidal processes were important for deposition of the Barreiras Formation located in northern Brazil, while correlatable deposits in northeastern Brazil have been traditionally related to continental environments. Facies analysis in southern Alagoas revealed that the Barreiras Formation consists of cross-stratified conglomerates and sandstones (facies Sx and Cgx), compound cross-stratified sandstones (facies Cx), and heterolithic beddings (facies H). A significant portion of these deposits occurs within channel morphologies displaying fining and thinning upward successions. An abundance of sedimentary features is comparable to those from the northern Brazilian counterpart. These include: tidal bundles; herringbone cross-stratification; heterolithic beddings with sandstone and mudstone beds in sharp contacts; and ichnofossils mostly consisting of Ophiomorpha nodosa, Skolithos and Planolites. Altogether, these features point to a marginal marine depositional setting dominated by tidal processes, which are related to an estuarine system, an interpretation also provided for the Barreiras Formation in northern Brazil. The widespread occurrence of deposits with unambiguous evidence of tidal processes in the Barreiras Formation of northern Brazil, and now in the State of Alagoas, leads to argue that the early/middle Miocene worldwide marine transgression might have left a much more widespread sedimentary record along the Brazilian coast than currently regarded.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cuticle renewal is a complex biological process that depends on the cross talk between hormone levels and gene expression. This study characterized the expression of two genes encoding cuticle proteins sharing the four conserved amino acid blocks of the Tweedle family, AmelTwdl1 and AmelTwdl2, and a gene encoding a cuticle peroxidase containing the Animal haem peroxidase domain, Ampxd, in the honey bee. Gene sequencing and annotation validated the formerly predicted tweedle genes, and revealed a novel gene, Ampxd, in the honey bee genome. Expression of these genes was studied in the context of the ecdysteroid-coordinated pupal-to-adult molt, and in different tissues. Higher transcript levels were detected in the integument after the ecdysteroid peak that induces apolysis, coinciding with the synthesis and deposition of the adult exoskeleton and its early differentiation. The effect of this hormone was confirmed in vivo by tying a ligature between the thorax and abdomen of early pupae to prevent the abdominal integument from coming in contact with ecdysteroids released from the prothoracic gland. This procedure impaired the natural increase in transcript levels in the abdominal integument. Both tweedle genes were expressed at higher levels in the empty gut than in the thoracic integument and trachea of pharate adults. In contrast, Ampxd transcripts were found in higher levels in the thoracic integument and trachea than in the gut. Together, the data strongly suggest that these three genes play roles in ecdysteroid-dependent exoskeleton construction and differentiation and also point to a possible role for the two tweedle genes in the formation of the cuticle (peritrophic membrane) that internally lines the gut.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: The aim of this study was to investigate the efficacy of an infrared GaAlAs laser operating with a wavelength of 830 nm in the postsurgical scarring process after inguinal-hernia surgery. Background: Low-level laser therapy (LLLT) has been shown to be beneficial in the tissue-repair process, as previously demonstrated in tissue culture and animal experiments. However, there is lack of studies on the effects of LLLT on postsurgical scarring of incisions in humans using an infrared 830-nm GaAlAs laser. Method: Twenty-eight patients who underwent surgery for inguinal hernias were randomly divided into an experimental group (G1) and a control group (G2). G1 received LLLT, with the first application performed 24 h after surgery and then on days 3, 5, and 7. The incisions were irradiated with an 830-nm diode laser operating with a continuous power output of 40 mW, a spot-size aperture of 0.08 cm(2) for 26 s, energy per point of 1.04 J, and an energy density of 13 J/cm(2). Ten points per scar were irradiated. Six months after surgery, both groups were reevaluated using the Vancouver Scar Scale (VSS), the Visual Analog Scale, and measurement of the scar thickness. Results: G1 showed significantly better results in the VSS totals (2.14 +/- 1.51) compared with G2 (4.85 +/- 1.87); in the thickness measurements (0.11 cm) compared with G2 (0.19 cm); and in the malleability (0.14) compared with G2 (1.07). The pain score was also around 50% higher in G2. Conclusion: Infra-red LLLT (830 nm) applied after inguinal-hernia surgery was effective in preventing the formation of keloids. In addition, LLLT resulted in better scar appearance and quality 6 mo postsurgery.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. The luminous material in clusters of galaxies exists in two forms: the visible galaxies and the X-ray emitting intra-cluster medium. The hot intra-cluster gas is the major observed baryonic component of clusters, about six times more massive than the stellar component. The mass contained within visible galaxies is approximately 3% of the dynamical mass. Aims. Our aim was to analyze both baryonic components, combining X-ray and optical data of a sample of five galaxy clusters (Abell 496, 1689, 2050, 2631 and 2667), within the redshift range 0.03 < z < 0.3. We determined the contribution of stars in galaxies and the intra-cluster medium to the total baryon budget. Methods. We used public XMM-Newton data to determine the gas mass and to obtain the X-ray substructures. Using the optical counterparts from SDSS or CFHT we determined the stellar contribution. Results. We examine the relative contribution of galaxies, intra-cluster light and intra-cluster medium to baryon budget in clusters through the stellar-to-gas mass ratio, estimated with recent data. We find that the stellar-to-gas mass ratio within r(500) (the radius within which the mean cluster density exceeds the critical density by a factor of 500), is anti-correlated with the ICM temperature, which range from 24% to 6% while the temperature ranges from 4.0 to 8.3 keV. This indicates that less massive cold clusters are more prolific star forming environments than massive hot clusters.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We use multiwavelength data (H I, FUV, NUV, R) to search for evidence of star formation in the intragroup medium of the Hickson Compact Group 100. We find that young star-forming regions are located in the intergalactic H I clouds of the compact group which extend to over 130 kpc away from the main galaxies. A tidal dwarf galaxy (TDG) candidate is located in the densest region of the H I tail, 61 kpc from the brightest group member and its age is estimated to be only 3.3 Myr. Fifteen other intragroup H II regions and TDG candidates are detected in the Galaxy Evolution Explorer (GALEX) FUV image and within a field 10' x 10' encompassing the H I tail. They have ages <200 Myr, H I masses of 10(9.2-10.4) M(circle dot), 0.001

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. The formation of ultra-compact dwarf galaxies (UCDs) is believed to be driven by interaction, and UCDs are abundant in the cores of galaxy clusters, environments that mark the end-point of galaxy evolution. Nothing is known about the properties of UCDs in compact groups of galaxies, environments where most of galaxy evolution and interaction is believed to occur and where UCDs in an intermediate stage in their evolution may be expected. Aims. The main goal of this study is to detect and characterize, for the first time, the UCD population of compact groups of galaxies. For that, two nearby groups in different evolutionary stages, HCG22 and HCG90, were targeted. Methods. We selected about 40 UCD candidates from pre-existing photometry of both groups, and obtained spectra of these candidates using the VLT FORS2 instrument in MXU mode. Archival HST/ACS imaging was used to measure their structural parameters. Results. We detect 16 and 5 objects belonging to HCG22 and HCG90, respectively, covering the magnitude range -10.0 > M(R) > -11.5 mag. Their integrated colours are consistent with old ages covering a broad range in metallicities (metallicities confirmed by the spectroscopic measurements). Photometric mass estimates put 4 objects in HCG90 and 9 in HCG22 in the mass range of UCDs (> 2 x 10(6) M(circle dot)) for an assumed age of 12Gyr. These UCDs are on average 2-3 times larger than the typical size of Galactic GCs, covering a range of 2 less than or similar to r(h) less than or similar to 21 pc. The UCDs in HCG22 are more concentrated around the central galaxy than in HCG90, at the 99% confidence level. They cover a broad range in [alpha/Fe] abundances from sub-to super-solar. The spectra of 3 UCDs (2 in HCG22, 1 in HCG90) show tentative evidence of intermediate age stellar populations. The clearest example is the largest and most massive UCD (similar to 10(7) M(circle dot)) in our sample, which is detected in HCG22. Its properties are most consistent with a stripped dwarf galaxy nucleus. We calculate the specific frequency (S(N)) of UCDs for both groups, finding that HCG22 has about three times higher S(N) than HCG90. Conclusions. The ensemble properties of the detected UCDs supports two co-existing formation channels: a star cluster origin (low-luminosity, compact sizes, old ages, super-solar alpha/Fe), and an origin as tidally stripped dwarf nuclei (more extended and younger stellar populations). Our results imply that the UCDs detected in both groups do not, in their majority, originate from relatively recent galaxy interactions. Most of the detected UCDs have likely been brought into the group along with their host galaxies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. Two main scenarios for the formation of the Galactic bulge are invoked, the first one through gravitational collapse or hierarchical merging of subclumps, the second through secular evolution of the Galactic disc. Aims. We aim to constrain the formation of the Galactic bulge through studies of the correlation between kinematics and metallicities in Baade's Window (l = 1 degrees, b = -4 degrees) and two other fields along the bulge minor axis (l = 0 degrees, b = -6 degrees and b = -12 degrees). Methods. We combine the radial velocity and the [Fe/H] measurements obtained with FLAMES/GIRAFFE at the VLT with a spectral resolution of R = 20 000, plus for the Baade's Window field the OGLE-II proper motions, and compare these with published N-body simulations of the Galactic bulge. Results. We confirm the presence of two distinct populations in Baade's Window found in Hill et al. (2010, A&A, submitted): the metal-rich population presents bar-like kinematics while the metal-poor population shows kinematics corresponding to an old spheroid or a thick disc. In this context the metallicity gradient along the bulge minor axis observed by Zoccali et al. (2008, A&A, 486, 177), visible also in the kinematics, can be related to a varying mix of these two populations as one moves away from the Galactic plane, alleviating the apparent contradiction between the kinematic evidence of a bar and the existence of a metallicity gradient. Conclusions. We show evidence that the two main scenarios for the bulge formation co-exist within the Milky Way bulge.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We discuss the properties of homogeneous and isotropic flat cosmologies in which the present accelerating stage is powered only by the gravitationally induced creation of cold dark matter (CCDM) particles (Omega(m) = 1). For some matter creation rates proposed in the literature, we show that the main cosmological functions such as the scale factor of the universe, the Hubble expansion rate, the growth factor, and the cluster formation rate are analytically defined. The best CCDM scenario has only one free parameter and our joint analysis involving baryonic acoustic oscillations + cosmic microwave background (CMB) + SNe Ia data yields (Omega) over tilde = 0.28 +/- 0.01 (1 sigma), where (Omega) over tilde (m) is the observed matter density parameter. In particular, this implies that the model has no dark energy but the part of the matter that is effectively clustering is in good agreement with the latest determinations from the large- scale structure. The growth of perturbation and the formation of galaxy clusters in such scenarios are also investigated. Despite the fact that both scenarios may share the same Hubble expansion, we find that matter creation cosmologies predict stronger small scale dynamics which implies a faster growth rate of perturbations with respect to the usual Lambda CDM cosmology. Such results point to the possibility of a crucial observational test confronting CCDM with Lambda CDM scenarios through a more detailed analysis involving CMB, weak lensing, as well as the large-scale structure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

NGC 1275, the central galaxy in the Perseus cluster, is the host of gigantic hot bipolar bubbles inflated by active galactic nucleus (AGN) jets observed in the radio as Perseus A. It presents a spectacular H alpha-emitting nebulosity surrounding NGC 1275, with loops and filaments of gas extending to over 50 kpc. The origin of the filaments is still unknown, but probably correlates with the mechanism responsible for the giant buoyant bubbles. We present 2.5 and three-dimensional magnetohydrodynamical (MHD) simulations of the central region of the cluster in which turbulent energy, possibly triggered by star formation and supernovae (SNe) explosions, is introduced. The simulations reveal that the turbulence injected by massive stars could be responsible for the nearly isotropic distribution of filaments and loops that drag magnetic fields upward as indicated by recent observations. Weak shell-like shock fronts propagating into the intracluster medium (ICM) with velocities of 100-500 km s(-1) are found, also resembling the observations. The isotropic outflow momentum of the turbulence slows the infall of the ICM, thus limiting further starburst activity in NGC 1275. As the turbulence is subsonic over most of the simulated volume, the turbulent kinetic energy is not efficiently converted into heat and additional heating is required to suppress the cooling flow at the core of the cluster. Simulations combining the MHD turbulence with the AGN outflow can reproduce the temperature radial profile observed around NGC 1275. While the AGN mechanism is the main heating source, the SNe are crucial to isotropize the energy distribution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. Compact groups of galaxies are entities that have high densities of galaxies and serve as laboratories to study galaxy interactions, intergalactic star formation and galaxy evolution. Aims. The main goal of this study is to search for young objects in the intragroup medium of seven compact groups of galaxies: HCG 2, 7, 22, 23, 92, 100 and NGC 92 as well as to evaluate the stage of interaction of each group. Methods. We used Fabry-Perot velocity fields and rotation curves together with GALEX NUV and FUV images and optical R-band and HI maps. Results. (i) HCG 7 and HCG 23 are in early stages of interaction; (ii) HCG 2 and HCG 22 are mildly interacting; and (iii) HCG 92, HCG 100 and NGC 92 are in late stages of evolution. We find that all three evolved groups contain populations of young blue objects in the intragroup medium, consistent with ages < 100 Myr, of which several are younger than < 10 Myr. We also report the discovery of a tidal dwarf galaxy candidate in the tail of NGC 92. These three groups, besides containing galaxies that have peculiar velocity fields, also show extended HI tails. Conclusions. Our results indicate that the advanced stage of evolution of a group, together with the presence of intragroup HI clouds, may lead to star formation in the intragroup medium. A table containing all intergalactic HII regions and tidal dwarf galaxies confirmed to date is appended.