905 resultados para 620201 Stone fruit
Resumo:
Stone-fruit activated carbon (SAC) and modified versions containing acidic oxygen and basic nitrogen groups have been used to prepare palladium catalysts by wet impregnation. Carbon supports and catalysts are investigated by thermo-gravimetric analysis, TPD, oxygen chemisorption, TEM and XPS. The influence of the nature of the functional groups on the dispersion and oxidation state of palladium and its activity in hydrogen oxidation is investigated. Pd dispersion is found to increase with the basic strength of functional groups on the support. XPS reveals that introduction of amine groups in SAC results in an increased proportion of Pd0, resistant to re-oxidation. Palladium catalysts supported on activated carbon modified by diethylamine groups are found to exhibit the highest metal dispersion and greatest activity in hydrogen oxidation. © 2007 Elsevier B.V. All rights reserved.
Resumo:
Anastrepha parishi Stone, 1942 was reared in fruits of Oenocarpus bacaba Martius, 1823 (Arecaceae) collected in Pracuúba, State of Amapá. This is the first record of an Anastrepha species in a native species of Arecaceae.
Resumo:
This work was carried out to show the current situation of the temperate fruit crops in São Paulo state, Brazil, with an emphasis on grapes, peaches, apples, plums, nectarines and pears crops. Current economic data of crops, major growing regions, main cultivars produced, as well as the new technologies generated by research are presented. Regarding the grape crop, a decrease in the national production as well as in the major growing states was observed. The main grapes growing centers in São Paulo state are presented, highlighting its peculiarities regarding cultivars, cultural crop management and current researches. A trend has been observed toward increasing Niagara Rosada grape growing area rather than the fine table grape cultivars. It was also observed the adoption of cultural practices, aiming to increase productivity, to improve the fruits quality and to reduce manpower necessity. In terms of stone fruits, peaches are the most widely cultivated in São Paulo state, followed by plums and nectarines. Both for stone fruits crop and for apples and pears crops, statistics and comments are presented on the crops evolution as well as the current researches results and the requirements of these fruit crops in São Paulo state, Brazil.
Resumo:
To investigate the contribution of paternal alleles to the DNA content of olive oil, genetic analyses of olive DNA samples from fruits, leaves, and oil derived from the same tree (cv. Leccino) were carried out. DNA extracted from maternal tissues--leaves and flesh--from different fruits showed identical genetic profiles using a set of DNA markers. Additional simple sequence repeat (SSR) alleles, not found in the maternal samples, were amplified in the embryos (stone), and they were also detected in DNA extracted from the paste obtained by crushing whole fruits and from the oil pressed from this material. These results demonstrate that the DNA profile obtained from olive oil is likely to represent a composite profile of the maternal alleles juxtaposed with alleles contributed by various pollen donors. Therefore, care needs to be taken in the interpretation of DNA profiles obtained from DNA extracted from oil for resolving provenance and authenticity issues.
Resumo:
Besides being considered the greatest pests of fruit growing, fruit flies constitute a large obstacle to the growth of the exportation of fresh fruit. Knowledge of the structure of fruit fly communities is of great importance to the bioecological studies of these insects, but there is a lack of information about the faunistic composition of fruit flies in Brazil. The objective of this work was to analysis the composition of the species of Anastrepha, in eleven mango orchards of the fruit growing complex Gaviao River, Bahia, Brazil. These studies were done in 2004 and 2005, in Anage, Caraibas and Belo Campo town, 23 McPhail traps, which collected 798 female fruit flies from the genus Anastrepha. The structure of these communities was evaluated in each orchard by means of faunistic indexes frequency, constancy, dominance, diversity and similarity. The number of species varied from four to eight in each orchard; and the following species was recorded: Anastrepha fraterculus (Wiedemann), Anastrepha obliqua (Macquart), Anastrepha dissimilis Stone, Anastrepha amita Zucchi, Anastrepha distincta Greene, Anastrepha pickeli Lima. Anastrepha sororcula Zucchi and Anastrepha zenildae Zucchi. The most frequent and dominant species were A. fraterculus and A. obliqua. The indexes of diversity varied from 1.01 to 1.62. In general, the similarity between orchards was high (above 55.0%). We observed the formation of groups, one constituted by Frutvale, Carlan, Santa Clara and Panorama orchards; another composed of Cofet, Campo Gaviao and Ouro Verde and a third group formed by Boa Vista orchard. Barra da Onca and Arruda are distinguished from other orchards.
Resumo:
To determine whether tool use varied in relation to food availability in bearded capuchin monkeys, we recorded anvil and stone hammer use in two sympatric wild groups, one of which was provisioned daily, and assessed climatic variables and availability of fruits, invertebrates and palm nuts. Capuchins used tools to crack open encased fruits, mostly palm nuts, throughout the year. Significant differences between wet and dry seasons were found in rainfall, abundance of invertebrates and palm nuts, but not in fruit abundance. Catule nuts were more abundant in the dry season. We tested the predictions of the necessity hypothesis (according to which tool use is maintained by sustenance needs during resource scarcity) and of the opportunity hypothesis (according to which tool use is maintained by repeated exposure to appropriate ecological conditions, such as preferred food resources necessitating the use of tools). Our findings support only the opportunity hypothesis. The rate of tool use was not affected by provisioning, and the monthly rate of tool use was not correlated with the availability of fruits and invertebrates. Conversely, all capuchins cracked food items other than palm nuts (e.g. cashew nuts) when available, and adult males cracked nuts more in the dry season when catule nuts (the most common and exploited nut) are especially abundant. Hence, in our field site capuchins use tools opportunistically. (C) 2012 The Association for the Study of Animal Behaviour. Published by Elsevier Ltd. All rights reserved.
Resumo:
The brown rot fungi belong to a group of fungal pathogens that causes considerable damage to cultivated fruits trees, particularly stone fruits and apples in the temperate regions of the World and during the postharvest with an important economic impact. In particular in Italy, it is important to monitor the Monilinia population to control economic losses associated to the peach and nectarine market. This motivates the research steps presented in this dissertation on Monilinia Italian isolates. The Monilinia species collected from stone fruits have been identified using molecular analysis based on specific primers. The relevant role of M. fructicola was confirmed and, for the first time, it was found also on apple fruits. To avoid the development of resistant strains and implement valid treatment strategies, the understanding of the fruit natural resistance during different developmental stages and the assessment of the Monilinia sensitivity/resistance to fungicides are required. The relationship between the inhibition spots and the phenolic compounds in peach fruit peel was highlighted in this research. Three methods were used to assess isolate resistance/sensitivity, the amended medium, the Spiral Gradient Endpoint Method (SGD) and the Alamar Blue method. The PCR was used to find possible mutation points in the b-tubulin gene that is responsible for fungicide resistance. Interestingly, no mutation points were observed in resistant M. laxa isolates, suggesting that the resistance could be stimulated by environmental factors. This lead to the study of the effect of the temperature on the resistance and the preliminary results of in vitro tests showed that maximum inhibition was observed at 30°C.
Resumo:
Two electronic fruits (SEP-1, Simulated Electronic Product, developed in Scotland, and Techmark IS-100, Instrumented Sphere, developed in USA) have been compared in laboratory tests and then used to evaluate handling operations, in several cooperatives of two areas of Spain: Lérida (pome fruits) and Valencia (stone fruits). Advantages of each device were evaluated. Harvest, mechanical bin unloading, and grading line transfers and sizers were identified as operations causing fruit damage.
Resumo:
Mealiness is a negative attribute of sensory texture, characterised by the lack of juiciness decrease in the total amount of of water content of tissues. Peach mealy textures are known as \ and leatheriness. Besides the lack of juiciness and flavour, that characterises mealy fruits, in associated with internal browning near the stone and an incapacity of ripening although there i ripe appearance. It is considered as a physiological disorder that appears in stone fruits probably < unbalanced pectolitic enzyme activity during storage. Since January 1996, a wide EC Project entitled: "Mealiness in fruits. Consumer perception and i detection" is being carried out. Within it, the Physical Properties Laboratory (ETSIA-UPM) working to develop instrumental procedures to detect mealiness in different types of fruits (s contributions by Barreiro to AgEng). The results obtained have shown to correlate well with \ measurements in apples (Barreiro et al), also we have succeeded in identifying individual mealy j the basis of instrumental measurement in peaches. The definition of these texture categories will be used in further studies as a base for new individual classification.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
After a long incubation period, the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES) is now underway. Underpinning all its activities is the IPBES Conceptual Framework (CF), a simplified model of the interactions between nature and people. Drawing on the legacy of previous large-scale environmental assessments, the CF goes further in explicitly embracing different disciplines and knowledge systems (including indigenous and local knowledge) in the co-construction of assessments of the state of the world's biodiversity and the benefits it provides to humans. The CF can be thought of as a kind of Rosetta Stone that highlights commonalities between diverse value sets and seeks to facilitate crossdisciplinary and crosscultural understanding. We argue that the CF will contribute to the increasing trend towards interdisciplinarity in understanding and managing the environment. Rather than displacing disciplinary science, however, we believe that the CF will provide new contexts of discovery and policy applications for it.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.