989 resultados para quantitative detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Copy number variations (CNVs) have been shown to account for substantial portions of observed genomic variation and have been associated with qualitative and quantitative traits and the onset of disease in a number of species. Information from high-resolution studies to detect, characterize and estimate population-specific variant frequencies will facilitate the incorporation of CNVs in genomic studies to identify genes affecting traits of importance. Results: Genome-wide CNVs were detected in high-density single nucleotide polymorphism (SNP) genotyping data from 1,717 Nelore (Bos indicus) cattle, and in NGS data from eight key ancestral bulls. A total of 68,007 and 12,786 distinct CNVs were observed, respectively. Cross-comparisons of results obtained for the eight resequenced animals revealed that 92 % of the CNVs were observed in both datasets, while 62 % of all detected CNVs were observed to overlap with previously validated cattle copy number variant regions (CNVRs). Observed CNVs were used for obtaining breed-specific CNV frequencies and identification of CNVRs, which were subsequently used for gene annotation. A total of 688 of the detected CNVRs were observed to overlap with 286 non-redundant QTLs associated with important production traits in cattle. All of 34 CNVs previously reported to be associated with milk production traits in Holsteins were also observed in Nelore cattle. Comparisons of estimated frequencies of these CNVs in the two breeds revealed 14, 13, 6 and 14 regions in high (>20 %), low (<20 %) and divergent (NEL > HOL, NEL < HOL) frequencies, respectively. Conclusions: Obtained results significantly enriched the bovine CNV map and enabled the identification of variants that are potentially associated with traits under selection in Nelore cattle, particularly in genome regions harboring QTLs affecting production traits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sampling and preconcentration techniques play a critical role in headspace analysis in analytical chemistry. My dissertation presents a novel sampling design, capillary microextraction of volatiles (CMV), that improves the preconcentration of volatiles and semivolatiles in a headspace with high throughput, near quantitative analysis, high recovery and unambiguous identification of compounds when coupled to mass spectrometry. The CMV devices use sol-gel polydimethylsiloxane (PDMS) coated microglass fibers as the sampling/preconcentration sorbent when these fibers are stacked into open-ended capillary tubes. The design allows for dynamic headspace sampling by connecting the device to a hand-held vacuum pump. The inexpensive device can be fitted into a thermal desorption probe for thermal desorption of the extracted volatile compounds into a gas chromatography-mass spectrometer (GC-MS). The performance of the CMV devices was compared with two other existing preconcentration techniques, solid phase microextraction (SPME) and planar solid phase microextraction (PSPME). Compared to SPME fibers, the CMV devices have an improved surface area and phase volume of 5000 times and 80 times, respectively. One (1) minute dynamic CMV air sampling resulted in similar performance as a 30 min static extraction using a SPME fiber. The PSPME devices have been fashioned to easily interface with ion mobility spectrometers (IMS) for explosives or drugs detection. The CMV devices are shown to offer dynamic sampling and can now be coupled to COTS GC-MS instruments. Several compound classes representing explosives have been analyzed with minimum breakthrough even after a 60 min. sampling time. The extracted volatile compounds were retained in the CMV devices when preserved in aluminum foils after sampling. Finally, the CMV sampling device were used for several different headspace profiling applications which involved sampling a shipping facility, six illicit drugs, seven military explosives and eighteen different bacteria strains. Successful detection of the target analytes at ng levels of the target signature volatile compounds in these applications suggests that the CMV devices can provide high throughput qualitative and quantitative analysis with high recovery and unambiguous identification of analytes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The language connectome was in-vivo investigated using multimodal non-invasive quantitative MRI. In PPA patients (n=18) recruited by the IRCCS ISNB, Bologna, cortical thickness measures showed a predominant reduction on the left hemisphere (p<0.005) with respect to matched healthy controls (HC) (n=18), and an accuracy of 86.1% in discrimination from Alzheimer’s disease patients (n=18). The left temporal and para-hippocampal gyri significantly correlated (p<0.01) with language fluency. In PPA patients (n=31) recruited by the Northwestern University Chicago, DTI measures were longitudinally evaluated (2-years follow-up) under the supervision of Prof. M. Catani, King’s College London. Significant differences with matched HC (n=27) were found, tract-localized at baseline and widespread in the follow-up. Language assessment scores correlated with arcuate (AF) and uncinate (UF) fasciculi DTI measures. In left-ischemic stroke patients (n=16) recruited by the NatBrainLab, King’s College London, language recovery was longitudinally evaluated (6-months follow-up). Using arterial spin labelling imaging a significant correlation (p<0.01) between language recovery and cerebral blood flow asymmetry, was found in the middle cerebral artery perfusion, towards the right. In HC (n=29) recruited by the DIBINEM Functional MR Unit, University of Bologna, an along-tract algorithm was developed suitable for different tractography methods, using the Laplacian operator. A higher left superior temporal gyrus and precentral operculum AF connectivity was found (Talozzi L et al., 2018), and lateralized UF projections towards the left dorsal orbital cortex. In HC (n=50) recruited in the Human Connectome Project, a new tractography-driven approach was developed for left association fibres, using a principal component analysis. The first component discriminated cortical areas typically connected by the AF, suggesting a good discrimination of cortical areas sharing a similar connectivity pattern. The evaluation of morphological, microstructural and metabolic measures could be used as in-vivo biomarkers to monitor language impairment related to neurodegeneration or as surrogate of cognitive rehabilitation/interventional treatment efficacy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Congenital muscular dystrophy with laminin α2 chain deficiency (MDC1A) is one of the most severe forms of muscular disease and is characterized by severe muscle weakness and delayed motor milestones. The genetic basis of MDC1A is well known, yet the secondary mechanisms ultimately leading to muscle degeneration and subsequent connective tissue infiltration are not fully understood. In order to obtain new insights into the molecular mechanisms underlying MDC1A, we performed a comparative proteomic analysis of affected muscles (diaphragm and gastrocnemius) from laminin α2 chain-deficient dy(3K)/dy(3K) mice, using multidimensional protein identification technology combined with tandem mass tags. Out of the approximately 700 identified proteins, 113 and 101 proteins, respectively, were differentially expressed in the diseased gastrocnemius and diaphragm muscles compared with normal muscles. A large portion of these proteins are involved in different metabolic processes, bind calcium, or are expressed in the extracellular matrix. Our findings suggest that metabolic alterations and calcium dysregulation could be novel mechanisms that underlie MDC1A and might be targets that should be explored for therapy. Also, detailed knowledge of the composition of fibrotic tissue, rich in extracellular matrix proteins, in laminin α2 chain-deficient muscle might help in the design of future anti-fibrotic treatments. All MS data have been deposited in the ProteomeXchange with identifier PXD000978 (http://proteomecentral.proteomexchange.org/dataset/PXD000978).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To analyze the main factors that influence bone mass in children and teenagers assessed by quantitative ultrasound (QUS) of the phalanges. A systematic literature review was performed according to the PRISMA method with searches in databases Pubmed/Medline, SciELO and Bireme for the period 2001-2012, in English and Portuguese languages, using the keywords: children, teenagers, adolescent, ultrasound finger phalanges, quantitative ultrasound of phalanges, phalangeal quantitative ultrasound. 21 articles were included. Girls had, in QUS, Amplitude Dependent Speed of Sound (AD-SoS) values higher than boys during pubertal development. The values of the parameters of QUS of the phalanges and dual-energy X-ray Absorptiometry (DXA) increased with the increase of the maturational stage. Anthropometric variables such as age, weight, height, body mass index (BMI), lean mass showed positive correlations with the values of QUS of the phalanges. Physical activity has also been shown to be positively associated with increased bone mass. Factors such as ethnicity, genetics, caloric intake and socioeconomic profile have not yet shown a conclusive relationship and need a larger number of studies. QUS of the phalanges is a method used to evaluate the progressive acquisition of bone mass during growth and maturation of individuals in school phase, by monitoring changes that occur with increasing age and pubertal stage. There were mainly positive influences in variables of sex, maturity, height, weight and BMI, with similar data when compared to the gold standard method, the DXA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.995detection (28.85-333.3pg/mL), limit of quantification (96.15-1111pg/mL), inter- and intraday accuracy (>80%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to quantify radiographically the periapical bone resorption in dogs' teeth contaminated with bacterial endotoxin (LPS), associated or not with calcium hydroxide. After pulp tissue removal, 60 premolars were randomly assigned to 4 groups and were either filled with LPS (group 1), filled with LPS plus calcium hydroxide (group 2) or filled with saline (group 3) for a period of 30 days. In group 4, periapical lesion formation was induced with no canal treatment. Standardized radiographs were taken at the beginning of the treatment and after 30 days and the Image J Program was used for measurement of periapical lesion size. Periapical lesions were observed in groups 1 (average of 8.44 mm2) and 4 (average of 3.02 mm2). The lamina dura was intact and there were no areas of periapical bone resorption in groups 2 and 3. It may be concluded that calcium hydroxide was effective in inactivating LPS, as demonstrated by the absence of apical periodontitis in the roots that were filled with bacterial endotoxin plus calcium hydroxide.