990 resultados para human fibroblasts
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Retinitis pigmentosa (RP) represents a genetically heterogeneous group of retinal dystrophies affecting mainly the rod photoreceptors and in some instances also the retinal pigment epithelium (RPE) cells of the retina. Clinical symptoms and disease progression leading to moderate to severe loss of vision are well established and despite significant progress in the identification of causative genes, the disease pathology remains unclear. Lack of this understanding has so far hindered development of effective therapies. Here we report successful generation of human induced pluripotent stem cells (iPSC) from skin fibroblasts of a patient harboring a novel Ser331Cysfs*5 mutation in the MERTK gene. The patient was diagnosed with an early onset and severe form of autosomal recessive RP (arRP). Upon differentiation of these iPSC towards RPE, patient-specific RPE cells exhibited defective phagocytosis, a characteristic phenotype of MERTK deficiency observed in human patients and animal models. Thus we have created a faithful cellular model of arRP incorporating the human genetic background which will allow us to investigate in detail the disease mechanism, explore screening of a variety of therapeutic compounds/reagents and design either combined cell and gene- based therapies or independent approaches.
Resumo:
Objectives:The aim of this study was to assess the biological rationale for the use of platelet-rich plasma (PRP) by evaluating the effect of different concentrations of PRP on osteoblasts (OB) and fibroblasts (FB) function in vitro. Materials and methods:PRP was obtained from volunteer donors using standard protocols. Primary human cultures of oral FBs and OBs were exposed to both activated and non-activated plasma as well as various concentrations of PRP (2.5 x, 3.5 x and max (4.2-5.5 x)). Cell proliferation was evaluated after 24 and 72 h using an MTT proliferation assay. Production of osteocalcin (OCN), osteoprotegerin (OPG) and transforming growth factor beta 1 (TGF-beta 1) was evaluated in OB after 24 and 72 h. Statistical analysis was performed using one-way ANOVA. Results:PRP-stimulated cell proliferation in both OBs and FBs. The effect of different PRP concentrations on cell proliferation was most notable at 72 h. The maximum effect was achieved with a concentration of 2.5 x, with higher concentrations resulting in a reduction of cell proliferation. Upregulation of OCN levels and downregulation of OPG levels were noted with increasing PRP concentrations at both 24 and 72 h. TGF-beta 1 levels were stimulated by increasing concentrations of PRP, with the increased levels being maintained at 72 h. Conclusions:PRP preparations exert a dose-specific effect on oral FBs and OBs. Optimal results were observed at a platelet concentration of 2.5 x, which was approximately half of the maximal concentrate that could be obtained. Increased concentrations resulted in a reduction in proliferation and a suboptimal effect on OB function. Hence, different PRP concentrations may have an impact on the results that can be obtained in vivo.
Resumo:
Investigations were undertaken to study the role of the protein cross-linking enzyme tissue transglutaminase in changes associated with the extracellular matrix and in the cell death of human dermal fibroblasts following exposure to a solarium ultraviolet A source consisting of 98.8% ultraviolet A and 1.2% ultraviolet B. Exposure to nonlethal ultraviolet doses of 60 to 120 kJ per m2 resulted in increased tissue transglutaminase activity when measured either in cell homogenates, "in situ" by incorporation of fluorescein-cadaverine into the extracellular matrix or by changes in the epsilon(gamma-glutamyl) lysine cross-link. This increase in enzyme activity did not require de novo protein synthesis. Incorporation of fluorescein-cadaverine into matrix proteins was accompanied by the cross-linking of fibronectin and tissue transglutaminase into nonreducible high molecular weight polymers. Addition of exogenous tissue transglutaminase to cultured cells mimicking extensive cell leakage of the enzyme resulted in increased extracellular matrix deposition and a decreased rate of matrix turnover. Exposure of cells to 180 kJ per m2 resulted in 40% to 50% cell death with dying cells showing extensive tissue transglutaminase cross-linking of intracellular proteins and increased cross-linking of the surrounding extracellular matrix, the latter probably occurring as a result of cell leakage of tissue transglutaminase. These cells demonstrated negligible caspase activation and DNA fragmentation but maintained their cell morphology. In contrast, exposure of cells to 240 kJ per m2 resulted in increased cell death with caspase activation and some DNA fragmentation. These cells could be partially rescued from death by addition of caspase inhibitors. These data suggest that changes in cross-linking both in the intracellular and extracellular compartments elicited by tissue transglutaminase following exposure to ultraviolet provides a rapid tissue stabilization process following damage, but as such may be a contributory factor to the scarring process that results.
Development of a multicellular co-culture model of normal and cystic fibrosis human airways in vitro
Resumo:
Cystic fibrosis (CF) is the most common lethal inherited disease among Caucasians and arises due to mutations in a chloride channel, called cystic fibrosis transmembrane conductance regulator. A hallmark of this disease is the chronic bacterial infection of the airways, which is usually, associated with pathogens such as Pseudomonas aeruginosa, S. aureus and recently becoming more prominent, B. cepacia. The excessive inflammatory response, which leads to irreversible lung damage, will in the long term lead to mortality of the patient at around the age of 40 years. Understanding the pathogenesis of CF currently relies on animal models, such as those employing genetically-modified mice, and on single cell culture models, which are grown either as polarised or non-polarised epithelium in vitro. Whilst these approaches partially enable the study of disease progression in CF, both types of models have inherent limitations. The overall aim of this thesis was to establish a multicellular co-culture model of normal and CF human airways in vitro, which helps to partially overcome these limitations and permits analysis of cell-to-cell communication in the airways. These models could then be used to examine the co-ordinated response of the airways to infection with relevant pathogens in order to validate this approach over animals/single cell models. Therefore epithelial cell lines of non-CF and CF background were employed in a co-culture model together with human pulmonary fibroblasts. Co-cultures were grown on collagen-coated permeable supports at air-liquid interface to promote epithelial cell differentiation. The models were characterised and essential features for investigating CF infections and inflammatory responses were investigated and analysed. A pseudostratified like epithelial cell layer was established at air liquid interface (ALI) of mono-and co-cultures and cell layer integrity was verified by tight junction (TJ) staining and transepithelial resistance measurements (TER). Mono- and co-cultures were also found to secrete the airway mucin MUC5AC. Influence of bacterial infections was found to be most challenging when intact S. aureus, B. cepacia and P. aeruginosa were used. CF mono- and co-cultures were found to mimic the hyperinflammatory state found in CF, which was confirmed by analysing IL-8 secretions of these models. These co-culture models will help to elucidate the role fibroblasts play in the inflammatory response to bacteria and will provide a useful testing platform to further investigate the dysregulated airway responses seen in CF.
Resumo:
The development and characterization of an enhanced composite skin substitute based on collagen and poly(e-caprolactone) are reported. Considering the features of excellent biocompatibility, easy-manipulated property and exempt from cross-linking related toxicity observed in the 1:20 biocomposites, skin substitutes were developed by seeding human single-donor keratinocytes and fibroblasts alone on both sides of the 1:20 biocomposite to allow for separation of two cell types and preserving cell signals transmission via micro-pores with a porosity of 28.8 ± 16.1 µm. The bi-layered skin substitute exhibited both differentiated epidermis and fibrous dermis in vitro. Less Keratinocyte Growth Factor production was measured in the co-cultured skin model compared to fibroblast alone condition indicating a favorable microenvironment for epidermal homeostasis. Moreover, fast wound closure, epidermal differentiation, and abundant dermal collagen deposition were observed in composite skin in vivo. In summary, the beneficial characteristics of the new skin substitutes exploited the potential for pharmaceutical screening and clinical application.
Resumo:
Characterizing engineered human lung tissue is an important step in developing a functional tissue replacement for lung tissue repair and in vitro analysis. Small tissue constructs were grown by seeding IMR-90 fetal lung fibroblasts and adult microvascular endothelial cells onto a Polyglycolic acid (PGA) polymer template. Introducing the constructs to dynamic culture conditions inside a bioreactor facilitated three-dimensional growth seen in scanning electron microscopy images (SEM). Characterization of the resultant tissue samples was done using SEM imagery, tensile tests, and biochemical assays to quantify extra-cellular matrix (ECM) composition. Tensile tests of the engineered samples indicated an increase in the mechanical properties when compared with blank constructs. Elastin and collagen content was found to average 3.19% and 15.49% respectively in relation to total mass of the tissue samples. The presence of elastin and collagen within the constructs most likely explains the mechanical differences that we noted. These findings suggest that the necessary ECM can be established in engineered tissue constructs and that optimization of this procedure has the capacity to generate the load bearing elements required for construction of a functional lung tissue equivalent.
Resumo:
Understanding the impact of extracellular matrix sub-types and mechanical stretch on cardiac fibroblast activity is required to help unravel the pathophysiology of myocardial fibrotic diseases. Therefore, the purpose of this study was to investigate pro-fibrotic responses of primary human cardiac fibroblast cells exposed to different extracellular matrix components, including collagen sub-types I, III, IV, VI and laminin. The impact of mechanical cyclical stretch and treatment with transforming growth factor beta 1 (TGFβ1) on collagen 1, collagen 3 and alpha smooth muscle actin mRNA expression on different matrices was assessed using quantitative real-time PCR. Our results revealed that all of the matrices studied not only affected the expression of pro-fibrotic genes in primary human cardiac fibroblast cells at rest but also affected their response to TGFβ1. In addition, differential cellular responses to mechanical cyclical stretch were observed depending on the type of matrix the cells were adhered to. These findings may give insight into the impact of selective pathological deposition of extracellular matrix proteins within different disease states and how these could impact the fibrotic environment.
Resumo:
Background: Recombinant human endostatin (Endostar) has been widely used to suppress angiogenesis in carcinoma patients. Hypertrophic scar (HS) tissue, much like a carcinoma, is often associated with angiogenesis. However, there have been few studies conducted on the effects of Endostar on HS or its mechanism. Objective: This paper investigated the effects Endostar on the HS of rabbit ears and studied the effects of Endostar on VEGF and TIMP-1 expression. Methods: Sixteen New Zealand white rabbits were used to establish HS models. Then, rabbit ears containing HS were randomly assigned to either the Endostar group or the control group. The changes of appearance and histology were evaluated using the naked eye, hematoxylin eosin staining, and a scar elevation index. The VEGF and TIMP-1 expressions were detected by immunohistochemical staining, RT-PCR, and western blot. Results: The thickness of the connective tissue in the Endostar group were thinner, the numbers of micro vessels and fibroblasts were fewer, and the collagen fibers were smoother. Moreover, the mRNA and protein expressions of VEGF and TIMP-1 in the Endostar group were significantly lower than those in the control group. Conclusion: The results suggested that Endostar reduced the formation of HS by down-regulation of VEGF and TIMP-1 expressions.
Resumo:
This study aimed at evaluating whether human papillomavirus (HPV) groups and E6/E7 mRNA of HPV 16, 18, 31, 33, and 45 are prognostic of cervical intraepithelial neoplasia (CIN) 2 outcome in women with a cervical smear showing a low-grade squamous intraepithelial lesion (LSIL). This cohort study included women with biopsy-confirmed CIN 2 who were followed up for 12 months, with cervical smear and colposcopy performed every three months. Women with a negative or low-risk HPV status showed 100% CIN 2 regression. The CIN 2 regression rates at the 12-month follow-up were 69.4% for women with alpha-9 HPV versus 91.7% for other HPV species or HPV-negative status (P < 0.05). For women with HPV 16, the CIN 2 regression rate at the 12-month follow-up was 61.4% versus 89.5% for other HPV types or HPV-negative status (P < 0.05). The CIN 2 regression rate was 68.3% for women who tested positive for HPV E6/E7 mRNA versus 82.0% for the negative results, but this difference was not statistically significant. The expectant management for women with biopsy-confirmed CIN 2 and previous cytological tests showing LSIL exhibited a very high rate of spontaneous regression. HPV 16 is associated with a higher CIN 2 progression rate than other HPV infections. HPV E6/E7 mRNA is not a prognostic marker of the CIN 2 clinical outcome, although this analysis cannot be considered conclusive. Given the small sample size, this study could be considered a pilot for future larger studies on the role of predictive markers of CIN 2 evolution.
Resumo:
Understanding the molecular mechanisms of oral carcinogenesis will yield important advances in diagnostics, prognostics, effective treatment, and outcome of oral cancer. Hence, in this study we have investigated the proteomic and peptidomic profiles by combining an orthotopic murine model of oral squamous cell carcinoma (OSCC), mass spectrometry-based proteomics and biological network analysis. Our results indicated the up-regulation of proteins involved in actin cytoskeleton organization and cell-cell junction assembly events and their expression was validated in human OSCC tissues. In addition, the functional relevance of talin-1 in OSCC adhesion, migration and invasion was demonstrated. Taken together, this study identified specific processes deregulated in oral cancer and provided novel refined OSCC-targeting molecules.
Resumo:
Human bocavirus 1 (HBoV1) is associated with respiratory infections worldwide, mainly in children. Similar to other parvoviruses, it is believed that HBoV1 can persist for long periods of time in humans, probably through maintaining concatemers of the virus single-stranded DNA genome in the nuclei of infected cells. Recently, HBoV-1 was detected in high rates in adenoid and palatine tonsils samples from patients with chronic adenotonsillar diseases, but nothing is known about the virus replication levels in those tissues. A 3-year prospective hospital-based study was conducted to detect and quantify HBoV1 DNA and mRNAs in samples of the adenoids (AD), palatine tonsils (PT), nasopharyngeal secretions (NPS), and peripheral blood (PB) from patients undergoing tonsillectomy for tonsillar hypertrophy or recurrent tonsillitis. HBoV1 was detected in 25.3% of the AD samples, while the rates of detection in the PT, NPS, and PB samples were 7.2%, 10.5%, and 1.7%, respectively. The viral loads were higher in AD samples, and 27.3% of the patients with HBoV had mRNA detectable in this tissue. High viral loads and detectable mRNA in the AD were associated with HBoV1 detection in the other sample sites. The adenoids are an important site of HBoV1 replication and persistence in children with tonsillar hypertrophy. The adenoids contain high HBoV1 loads and are frequently positive for HBoV mRNA, and this is associated with the detection of HBoV1 in secretions.
Resumo:
Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.
Resumo:
Lawsonia inermis mediated synthesis of silver nanoparticles (Ag-NPs) and its efficacy against Candida albicans, Microsporum canis, Propioniabacterium acne and Trichophyton mentagrophytes is reported. A two-step mechanism has been proposed for bioreduction and formation of an intermediate complex leading to the synthesis of capped nanoparticles was developed. In addition, antimicrobial gel for M. canis and T. mentagrophytes was also formulated. Ag-NPs were synthesized by challenging the leaft extract of L. inermis with 1 mM AgNO₃. The Ag-NPs were characterized by Ultraviolet-Visible (UV-Vis) spectrophotometer and Fourier transform infrared spectroscopy (FTIR). Transmission electron microscopy (TEM), nanoparticle tracking and analysis sytem (NTA) and zeta potential was measured to detect the size of Ag-NPs. The antimicrobial activity of Ag-NPs was evaluated by disc diffusion method against the test organisms. Thus these Ag-NPs may prove as a better candidate drug due to their biogenic nature. Moreover, Ag-NPs may be an answer to the drug-resistant microorganisms.
Resumo:
Avian pathogenic Escherichia coli (APEC) strains belong to a category that is associated with colibacillosis, a serious illness in the poultry industry worldwide. Additionally, some APEC groups have recently been described as potential zoonotic agents. In this work, we compared APEC strains with extraintestinal pathogenic E. coli (ExPEC) strains isolated from clinical cases of humans with extra-intestinal diseases such as urinary tract infections (UTI) and bacteremia. PCR results showed that genes usually found in the ColV plasmid (tsh, iucA, iss, and hlyF) were associated with APEC strains while fyuA, irp-2, fepC sitDchrom, fimH, crl, csgA, afa, iha, sat, hlyA, hra, cnf1, kpsMTII, clpVSakai and malX were associated with human ExPEC. Both categories shared nine serogroups (O2, O6, O7, O8, O11, O19, O25, O73 and O153) and seven sequence types (ST10, ST88, ST93, ST117, ST131, ST155, ST359, ST648 and ST1011). Interestingly, ST95, which is associated with the zoonotic potential of APEC and is spread in avian E. coli of North America and Europe, was not detected among 76 APEC strains. When the strains were clustered based on the presence of virulence genes, most ExPEC strains (71.7%) were contained in one cluster while most APEC strains (63.2%) segregated to another. In general, the strains showed distinct genetic and fingerprint patterns, but avian and human strains of ST359, or ST23 clonal complex (CC), presented more than 70% of similarity by PFGE. The results demonstrate that some zoonotic-related STs (ST117, ST131, ST10CC, ST23CC) are present in Brazil. Also, the presence of moderate fingerprint similarities between ST359 E. coli of avian and human origin indicates that strains of this ST are candidates for having zoonotic potential.