988 resultados para heavy rainfall events


Relevância:

20.00% 20.00%

Publicador:

Resumo:

El Niño South Oscillation (ENSO) is one climatic phenomenon related to the inter-annual variability of global meteorological patterns influencing sea surface temperature and rainfall variability. It influences human health indirectly through extreme temperature and moisture conditions that may accelerate the spread of some vector-borne viral diseases, like dengue fever (DF). This work examines the spatial distribution of association between ENSO and DF in the countries of the Americas during 1995-2004, which includes the 1997-1998 El Niño, one of the most important climatic events of 20(th) century. Data regarding the South Oscillation index (SOI), indicating El Niño-La Niña activity, were obtained from Australian Bureau of Meteorology. The annual DF incidence (AIy) by country was computed using Pan-American Health Association data. SOI and AIy values were standardised as deviations from the mean and plotted in bars-line graphics. The regression coefficient values between SOI and AIy (rSOI,AI) were calculated and spatially interpolated by an inverse distance weighted algorithm. The results indicate that among the five years registering high number of cases (1998, 2002, 2001, 2003 and 1997), four had El Niño activity. In the southern hemisphere, the annual spatial weighted mean centre of epidemics moved southward, from 6° 31' S in 1995 to 21° 12' S in 1999 and the rSOI,AI values were negative in Cuba, Belize, Guyana and Costa Rica, indicating a synchrony between higher DF incidence rates and a higher El Niño activity. The rSOI,AI map allows visualisation of a graded surface with higher values of ENSO-DF associations for Mexico, Central America, northern Caribbean islands and the extreme north-northwest of South America.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

American tegumentary leishmaniasis (ATL) is a disease transmitted to humans by the female sandflies of the genus Lutzomyia. Several factors are involved in the disease transmission cycle. In this work only rainfall and deforestation were considered to assess the variability in the incidence of ATL. In order to reach this goal, monthly recorded data of the incidence of ATL in Orán, Salta, Argentina, were used, in the period 1985-2007. The square root of the relative incidence of ATL and the corresponding variance were formulated as time series, and these data were smoothed by moving averages of 12 and 24 months, respectively. The same procedure was applied to the rainfall data. Typical months, which are April, August, and December, were found and allowed us to describe the dynamical behavior of ATL outbreaks. These results were tested at 95% confidence level. We concluded that the variability of rainfall would not be enough to justify the epidemic outbreaks of ATL in the period 1997-2000, but it consistently explains the situation observed in the years 2002 and 2004. Deforestation activities occurred in this region could explain epidemic peaks observed in both years and also during the entire time of observation except in 2005-2007.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article deals with the scavenging processes modeling of the particulate sulfate and the gas sulfur dioxide, emphasizing the synoptic conditions at different sampling sites in order to verify the domination of the in-cloud or below-cloud scavenging processes in the Metropolitan Area of São Paulo (RMSP). Three sampling sites were chosen: GV (Granja Viana) at RMSP surroundings, IAG-USP and Mackenzie (RMSP center). Basing on synoptic conditions, it was chosen a group of events where the numerical modeling, a simple scavenging model, was used. These synoptic conditions were usually convective cloud storms, which are usual at RMSP. The results show that the in-cloud processes were dominant (80%) for sulfate/sulfur dioxide scavenging processes, with below-cloud process indicating around 20% of the total. Clearly convective events, with total rainfall higher than 20 mm, are better modeled than the stratiform events, with correlation coefficient of 0.92. There is also a clear association with events presenting higher rainfall amount and the ratio between modeled and observed data set with correlation coefficient of 0.63. Additionally, the suburb sampling site, GV, as expected due to the pollution source distance, presents in general smaller amount of rainwater sulfate (modeled and observed) than the center sampling site, Mackenzie, where the characterization event explains partially the rainfall concentration differences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rainfall samples collected in the downtown area of São Paulo city, during 2003, exhibited average concentrations of cadmium, lead and copper of 1.33, 8.52 and 49.5 nmol L-1, respectively. Among the major ions, NH4+ was the predominant species followed by NO3-, SO4(2-) and Ca2+, with volume weighed mean (VWM) concentrations of 37.1, 20.1, 11.9 and 10.8 µmol L-1, respectively. All the determined species showed high inter-events variability, including free H+ ions whose VWM concentration was 4.03 µmol L-1, corresponding to a pH value of 5.39.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este trabalho investiga a variabilidade do Sistema de Monções da América do Sul (SMAS) sobre o Brasil com particular interesse na região do cerrado brasileiro. O início, final e total de precipitação durante as monções de verão são examinados utilizando estimativas de precipitação por satélite (pêntadas) do Global Precipitation Climatology Project (GPCP) entre 1979-2004. Analogamente, as características do regime de monção simuladas pelo modelo climático global acoplado MIROC (Model for interdisciplinary Research on Climate) do IPCC (Intergovernmental Panel for Climate Change) são examinadas em dois cenários distintos: o clima do século XX (1981-2000) e o clima em uma condição com o dobro da concentração atual de CO2 (2xCO2) na atmosfera (2061-2080). Mostra-se que a variabilidade espacial do início da monção de verão sobre o cerrado na simulação do clima do século XX pelo MIROC corresponde bem às observações. Além disso, há indicação de uma mudança das caudas da distribuição sazonal da precipitação no Cerrado para um cenário com 2xCO2, comparativamente com o clima presente. Este resultado sugere uma mudança na probabilidade de ocorrência de eventos extremos (secos ou úmidos) em um cenário com 2xCO2 sobre o cerrado, o que de acordo com o MIROC, indica uma maior exposição da região às conseqüências de possíveis mudanças climáticas resultantes do aumento de gases de efeito estufa.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines the role of parent rock, pedogenetic processes and airborne pollution in heavy metal accumulation in soils from a remote oceanic island, Fernando de Noronha, Brazil. We studied five soil profiles developed from different volcanic rocks. Mineralogical composition and total concentrations of major and trace elements were determined in 43 samples. The obtained concentrations range for heavy metals were: Co: 26-261 ppm; Cu: 35-97 ppm; Cr: 350-1446 ppm; Ni: 114-691 ppm; Zn: 101-374 ppm; Hg: 2-150 ppb. The composition of soils is strongly affected by the geochemical character of the parent rock. Pedogenesis appears to be responsible for the accumulation of Zn, Co, and, to a lesser extent, of Ni and Cu, in the upper, Mn- and organic carbon-enriched horizons of the soil profiles. Pedogenic influence may also explain the relationship observed between Cr and the Fe. Hg is likely to have been added to the soil profile by long-range atmospheric transport. Its accumulation in the topsoil was further favoured by the formation of stable complexes with organic matter. Clay minerals do not appear to play an important role in the fixation of heavy metals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We measure directed flow (v(1)) for charged particles in Au + Au and Cu + Cu collisions at root s(NN) = 200 and 62.4 GeV, as a function of pseudorapidity (eta), transverse momentum (p(t)), and collision centrality, based on data from the STAR experiment. We find that the directed flow depends on the incident energy but, contrary to all available model implementations, not on the size of the colliding system at a given centrality. We extend the validity of the limiting fragmentation concept to v(1) in different collision systems, and investigate possible explanations for the observed sign change in v(1)(p(t)).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present the first spin alignment measurements for the K*(0)(892) and phi(1020) vector mesons produced at midrapidity with transverse momenta up to 5 GeV/c at root s(NN) = 200 GeV at RHIC. The diagonal spin-density matrix elements with respect to the reaction plane in Au+Au collisions are rho(00) = 0.32 +/- 0.04 (stat) +/- 0.09 (syst) for the K*(0) (0.8 < p(T) < 5.0 GeV/c) and rho(00) = 0.34 +/- 0.02 (stat) +/- 0.03 (syst) for the phi (0.4 < p(T) < 5.0 GeV/c) and are constant with transverse momentum and collision centrality. The data are consistent with the unpolarized expectation of 1/3 and thus no evidence is found for the transfer of the orbital angular momentum of the colliding system to the vector-meson spins. Spin alignments for K(*0) and phi in Au+Au collisions were also measured with respect to the particle's production plane. The phi result, rho(00) = 0.41 +/- 0.02 (stat) +/- 0.04 (syst), is consistent with that in p+p collisions, rho(00) = 0.39 +/- 0.03 (stat) +/- 0.06 (syst), also measured in this work. The measurements thus constrain the possible size of polarization phenomena in the production dynamics of vector mesons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Photoproduction reactions occur when the electromagnetic field of a relativistic heavy ion interacts with another heavy ion. The STAR Collaboration presents a measurement of rho(0) and direct pi(+)pi(-) photoproduction in ultraperipheral relativistic heavy ion collisions at root s(NN) = 200 GeV. We observe both exclusive photoproduction and photoproduction accompanied by mutual Coulomb excitation. We find a coherent cross section of sigma(AuAu -> Au*Au*rho(0)) = 530 +/- 19(stat.) +/- 57(syst.) mb, in accord with theoretical calculations based on a Glauber approach, but considerably below the predictions of a color dipole model. The rho 0 transverse momentum spectrum (p(T)(2)) is fit by a double exponential curve including both coherent and incoherent coupling to the target nucleus; we find sigma(inc)/sigma(coh) = 0.29 +/- 0.03 (stat.) +/- 0.08 (syst.). The ratio of direct pi(+)pi(-) to rho(0) production is comparable to that observed in gamma(p) collisions at HERA and appears to be independent of photon energy. Finally, the measured rho(0) spin helicity matrix elements agree within errors with the expected s-channel helicity conservation.