955 resultados para Non-target species
Resumo:
Streamflow is considered a driver of inter and intra‐specific life‐history differences among freshwater fish. Therefore, dams and related flow regulation, can have deleterious impacts on their life‐cycles. The main objective of this study is to assess the effects of flow regulation on the growth and reproduction of a non‐migratory fish species. During one year, samples were collected from two populations of Iberian chub, inhabiting rivers with non‐regulated and regulated flow regimes. Flow regulation for water derivation promoted changes in chub’s condition, duration of gonad maturation and spawning, fecundity and oocyte size. However, this non‐migratory species was less responsive to streamflow regulation than a migratory species analysed. Findings from this study are important to understand changes imposed by regulated rivers on fish and can be used as guidelines for flow requirements implementations; RESUMO: O caudal é um dos fatores responsáveis pelo funcionamento dos ciclos de vida das espécies piscícolas dulciaquícolas. As barragens, e a regularização de caudal associada, podem ter impactes nos ciclos de vida destas espécies. O objetivo deste estudo prende‐se com a avaliação dos efeitos da regularização de caudal no crescimento e reprodução de uma espécie piscícola não‐migradora. A análise de amostras recolhidas em populações de escalo do Norte provenientes de dois rios de caudal regularizado e não regularizado, identificaram impactes significativos a nível da condição corporal, da maturação das gónadas e desova, da fecundidade e da dimensão dos oócitos. Esta espécie não‐migradora parece ser menos responsiva à artificialização do caudal que uma espécie migradora previamente analisada. Estes resultados permitem compreender as alterações impostas pela regularização do caudal e podem ser usados em programas de reabilitação fluvial.
Resumo:
Resumo: Predição da concentração de baixo risco de diflubenzuron para organismos aquáticos e avaliação da argila e brita na redução da toxicidade. O diflubenzuron é um inseticida que além de ser usado agricultura, tem sido amplamente empregado na piscicultura, apesar do seu uso ser proibido nesta atividade. Este composto não consta na lista da legislação brasileira que estabelece limites máximos permissíveis em corpos de água para a proteção das comunidades aquáticas. No presente trabalho, a partir da toxicidade do diflubenzuron em organismos não-alvo, foi calculada a concentração de risco para somente 5% das espécies (HC5). O valor deste parâmetro foi estimado em aproximadamente 7 x 10-6 mg L-1 . Este baixo valor é devido à extremamente alta toxicidade do diflubenzuron para dafnídeos e à grande variação de sensibilidade entre as espécies testadas. Dois matérias de relativamente baixo custo se mostraram eficientes na remoção da toxicidade do diflubenzuron de soluções contendo este composto. Dentre esses materiais, a argila expandida promoveu a redução em aproximadamente 50% da toxicidade de uma solução contendo diflubenzuron. Os resultados podem contribuir para políticas públicas no Brasil relacionadas ao estabelecimento de limites máximos permissíveis de xenobióticos no compartimento aquático. Também, para a pesquisa de matérias inertes e de baixo custo com potencial de remoção de xenobióticos presentes em efluentes da aquicultura ou da agricultura. Abstract: Diflubenzuron is an insecticide that, besides being used in the agriculture, has been widely used in fish farming. However, its use is prohibited in this activity. Diflubenzuron is not in the list of Brazilian legislation establishing maximum permissible limits in water bodies for the protection of aquatic communities. In this paper, according toxicity data of diflubenzuron in non-target organisms, it was calculated an hazardous concentration for only 5% of the species (HC5) of the aquatic community. This parameter value was estimated to be about 7 x 10 -6 mg L -1 . The low value is due to the extreme high toxicity of diflubenzuron to daphnids and to the large variation in sensitivity among the species tested. Two relatively low cost and inert materials were efficient in removing the diflubenzuron from solutions containing this compound. Among these materials, expanded clay shown to promote reduction of approximately 50% of the toxicity of a solution containing diflubenzuron. The results may contribute to the establishment of public policies in Brazil associated to the definition of maximum permissible limits of xenobiotics in the aquatic compartment. This study is also relevant to the search of low cost and inert materials for xenobiotics removal from aquaculture or agricultural effluents.
Resumo:
The western honey bee, Apis mellifera L., is currently the model specie for pesticide risk assessment on pollinators with the assumption that the worst-case scenarios for this species are sufficiently conservative to protect other insect pollinators. However, recent studies have showed that wild species may be more sensitive to plant protection products, due to differences in biology and life cycles. Therefore, there is the need to extend the risk assessment within a more ecological approach, in order to ensure that there are no irreversible effects on non-target organisms and in the environment. My dissertation aims to expand the risk assessment to other insect pollinators (including wild and managed pollinators), in order to cover some of the gaps of the current schemes. In this thesis, it is presented three experiments that cover the early stages of a solitary bee (chapter 1), the development of molecular tools for early detection of sub-lethal effects (chapter 2) and the development of protocols to access lethal and sub-lethal effects on other pollinator taxa (Diptera; chapter 3).
Resumo:
This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.
Resumo:
Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
After an ichthyofaunistic survey in several epigean (surface) water bodies of the Serra do Ramalho, southern Bahia, conducted in May 2007, 44 species were recorded; in addition, three non-troglomorphic (normally eyed and pigmented) and two troglomorphic species were recorded only in caves, totaling 49 species of fishes for the area, which represents a little more than one fourth of the total registered in the literature for the entire Rio São Francisco basin. In these caves, which have been studied since 2005, eight non-troglomorphic species were sampled and their presence in both epigean and subterranean habitats, associated to the lack of morphological differences, indicate that they may be either troglophiles (species encompassing individuals able to live and complete their life cycle either in the surface or in the subterranean environment), trogloxenes (individuals regularly found in subterranean habitats, but which must return periodically to the surface in order to complete their life cycle) or even accidental in caves. In addition, two troglomorphic species (with reduced eyes and melanic pigmentation when compared to close epigean relatives), belonging respectively to the genera Rhamdia and Trichomycterus, were recorded exclusively in caves, thus classified as troglobites. Interestingly, no epigean representative of the genus Trichomycterus was collected. The new data are integrated into updated lists of Brazilian troglobitic and troglophilic fishes, based on published data and new records recently confirmed.
Resumo:
Background: During mating, insect males eject accessory gland proteins (Acps) into the female genital tract. These substances are known to affect female post-mating behavior and physiology. In addition, they may harm the female, e. g., in reducing its lifespan. This is interpreted as a consequence of sexual antagonistic co-evolution. Whereas sexual conflict abounds in non-social species, the peculiar life history of social insects (ants, bees, wasps) with lifelong pair-bonding and no re-mating aligns the reproductive interests of the sexes. Harming the female during mating would negatively affect male fitness and sexual antagonism is therefore not expected. Indeed, mating appears to increase female longevity in at least one ant species. Acps are presumed to play a role in this phenomenon, but the underlying mechanisms are unknown. In this study, we investigated genes, which are preferentially expressed in male accessory glands of the ant Leptothorax gredleri, to determine which proteins might be transferred in the seminal fluid. Results: By a suppression subtractive hybridization protocol we obtained 20 unique sequences (USs). Twelve had mutual best matches with genes predicted for Apis mellifera and Nasonia vitripennis. Functional information (Gene Ontology) was available only for seven of these, including intracellular signaling, energy-dependent transport and metabolic enzyme activities. The remaining eight USs did not match sequences from other species. Six genes were further analyzed by quantitative RT-PCR in three life cycle stages of male ants. A gene with carboxy-lyase activity and one of unpredicted function were significantly overexpressed in accessory glands of sexually mature males. Conclusions: Our study is the first one to investigate differential gene expression in ants in a context related to mating. Our findings indicate that male accessory glands of L. gredleri express a series of genes that are unique to this species, possibly representing novel genes, in addition to conserved ones for which functions can be predicted. Identifying differentially expressed genes might help to better understand molecular mechanisms involved in reproductive processes in eusocial Hymenoptera. While the novel genes could account for rapidly evolving ones driven by intra-sexual conflict between males, conserved genes imply that rather beneficial traits might get fixed by a process described as inter-sexual cooperation between males and females.
Resumo:
Addressing spatial variability in nitrogen (N) availability in the Central Brazilian Amazon, we hypothesized that N availability varies among white-sand vegetation types (campina and campinarana) and lowland tropical forests (dense terra-firme forests) in the Central Brazilian Amazon, under the same climate conditions. Accordingly, we measured soil and foliar N concentration and N isotope ratios (delta(15)N) throughout the campina-campinarana transect and compared to published dense terra-firme forest results. There were no differences between white-sand vegetation types in regard to soil N concentration, C:N ratio and delta(15)N across the transect. Both white-sand vegetation types showed very low foliar N concentrations and elevated foliar C:N ratios, and no significant difference between site types was observed. Foliar delta(15)N was depleted, varying from -9.6 to 1.6aEuro degrees in the white-sand vegetations. The legume Aldina heterophylla had the highest average delta(15)N values (-1.5aEuro degrees) as well as the highest foliar N concentration (2.1%) while the non-legume species had more depleted delta(15)N values and the average foliar N concentrations varied from 0.9 to 1.5% among them. Despite the high variation in foliar delta(15)N among plants, a significant and gradual (15)N-enrichment in foliar isotopic signatures throughout the campina-campinarana transect was observed. Individual plants growing in the campinarana were significantly enriched in (15)N compared to those in campina. In the white-sand N-limited ecosystems, the differentiation of N use seems to be a major cause of variations observed in foliar delta(15)N values throughout the campina-campinarana transect.
Resumo:
Research documents related to the morphology and function of style branches and stigmatic surface of Asteraceae are still rather few, and the literature reports are thus controversial. We report in the present study that the stigmatic surfaces of two non-related species of Asteraceae (Lessingianthus grandiflorus and Lucilia lycopodioides) have features of semidry stigmas. Sporodermis of both species was also analyzed so that we could understand how the stigmatic surface works during pollen deposition and rehydration. Stylar branches and pollen grains (sporodermis) were studied using scanning and transmission electron microscopy (SEM and TEM) and histochemistry techniques. The inner and marginal bands of stylar branches in these species display intermediary features between the dry and wet types of stigma: the cuticle characterizes the dry stigma and cells with secretory activity characterize the wet stigma; these showed differences from what has been described to the Asteraceae family, where stigmatic surface of species from several tribes is considered dry. Pollen grains are medium-size to large with exine ornamentation (echinate and echinolophate) and abundant secretion which latter characterizes pollenkitt. We can assume that two processes might help pollen grain hydration on stigmatic surface in Lessingianthus grandiflorus and Lucilia lycopodioides: (1) the presence of pollenkitt, as observed in the secretory content inside exine cavities and around pollen grains; and (2) the secretory activity of stigmatic surface cells, whose secretion accumulates among intercellular and subcuticular spaces and leads to cuticle disruption during the floral receptive phase. Our results suggest that ultrastructural and histochemical studies should be considered when describing stigmatic surface and that the ""semidry"" feature within Asteraceae should be investigated still more in detail, so that the taxonomic or adaptation value of this trait in the family can be verified. (C) 2010 Elsevier GmbH. All rights reserved.
Resumo:
The aim of the present study was to evaluate the antimicrobial and cytotoxic activity of the ethanolic extract of S. cumini according to the Clinical and Laboratory Standards Institute reference method (with modifications), determining the minimal inhibitory and lethal concentration. Activity against Gram-positive (Staphylococcus aureus and S. epidermidis), Gram-negative (Pseudomonas aeruginosa) and yeast of Candida sp and Cryptococcus neoformans was evaluated. The effects of the fruit extract were examined in hamster cells ovaries in concentrations ranging from 1250.0 a 4.9 mu g/ml, measuring the reduction of the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulphophenyl)-2H-tetrazolium. The extract showed both bactericidal and fungicidal activity among the various microorganisms tested and the MIC ranging from 7.8 to 250 mu g/ml. The MIC, MBC and MFC should values that were similar for all the microorganisms. Cytotoxicity index of the dried extract corresponded to the concentration of 400 mu g/ml. The extract could potentially be used in topical antimicrobial products. Thus, the activity of extract was potent to bacteria and mainly to non-albicans species and C. neoformans.
Resumo:
Numerous everyday tasks require the nervous system to program a prehensile movement towards a target object positioned in a cluttered environment. Adult humans are extremely proficient in avoiding contact with any non-target objects (obstacles) whilst carrying out such movements. A number of recent studies have highlighted the importance of considering the control of reach-to-grasp (prehension) movements in the presence of such obstacles. The current study was constructed with the aim of beginning the task of studying the relative impact on prehension as the position of obstacles is varied within the workspace. The experimental design ensured that the obstacles were positioned within the workspace in locations where they did not interfere physically with the path taken by the hand when no obstacle was present. In all positions, the presence of an obstacle caused the hand to slow down and the maximum grip aperture to decrease. Nonetheless, the effect of the obstacle varied according to its position within the workspace. In the situation where an obstacle was located a small distance to the right of a target object, the obstacle showed a large effect on maximum grip aperture but a relatively small effect on movement time. In contrast, an object positioned in front and to the right of a target object had a large effect on movement speed but a relatively small effect on maximum grip aperture. It was found that the presence of two obstacles caused the system to decrease further the movement speed and maximum grip aperture. The position of the two obstacles dictated the extent to which their presence affected the movement parameters. These results show that the antic ipated likelihood of a collision with potential obstacles affects the planning of movement duration and maximum grip aperture in prehension.
Resumo:
The material in genebanks includes valuable traditional varieties and landraces, non-domesticated species, advanced and obsolete cultivars, breeding lines and genetic stock. It is the wide variety of potentially useful genetic diversity that makes collections valuable. While most of the yield increases to date have resulted from manipulation of a few major traits (such as height, photoperiodism, and vernalization), meeting future demand for increased yields will require exploitation of novel genetic resources. Many traits have been reported to have potential to enhance yield, and high expression of these can be found in germplasm collections. To boost yield in irrigated situations, spike fertility must be improved simultaneously with photosynthetic capacity. CIMMYT's Wheat Genetic Resources program has identified a source of multi-ovary florets, with up to 6 kernels per floret. Lines from landrace collections have been identified that have very high chlorophyll concentration, which may increase leaf photosynthetic rate. High chlorophyll concentration and high stomatal conductance are associated with heat tolerance. Recent studies, through augmented use of seed multiplication nurseries, identified high expression of these traits in bank accessions, and both traits were heritable. Searches are underway for drought tolerance traits related to remobilization of stem fructans, awn photosynthesis, osmotic adjustment, and pubescence. Genetic diversity from wild relatives through the production of synthetic wheats has produced novel genetic diversity.