Identification of characteristic volatile organic compounds released during the decomposition process of human remains and analogues

The manner in which remains decompose has been and is currently being researched around the world, yet little is still known about the generated scent of death. In fact, it was not until the Casey Anthony trial that research on the odor released from decomposing remains, and the compounds that it is comprised of, was brought to light. The Anthony trial marked the first admission of human decomposition odor as forensic evidence into the court of law; however, it was not "ready for prime time" as the scientific research on the scent of death is still in its infancy. This research employed the use of solid-phase microextraction (SPME) with gas chromatography-mass spectrometry (GC-MS) to identify the volatile organic compounds (VOCs) released from decomposing remains and to assess the impact that different environmental conditions had on the scent of death. Using human cadaver analogues, it was discovered that the environment in which the remains were exposed to dramatically affected the odors released by either modifying the compounds that it was comprised of or by enhancing/hindering the amount that was liberated. In addition, the VOCs released during the different stages of the decomposition process for both human remains and analogues were evaluated. Statistical analysis showed correlations between the stage of decay and the VOCs generated, such that each phase of decomposition was distinguishable based upon the type and abundance of compounds that comprised the odor. This study has provided new insight into the scent of death and the factors that can dramatically affect it, specifically, frozen, aquatic, and soil environments. Moreover, the results revealed that different stages of decomposition were distinguishable based upon the type and total mass of each compound present. Thus, based upon these findings, it is suggested that the training aids that are employed for human remains detection (HRD) canines should 1) be characteristic of remains that have undergone decomposition in different environmental settings, and 2) represent each stage of decay, to ensure that the HRD canines have been trained to the various odors that they are likely to encounter in an operational situation.

Far field of binary phase gratings with errors in the height of the strips

Diffraction gratings are not always ideal but, due to the fabrication process, several errors can be produced. In this work we show that when the strips of a binary phase diffraction grating present certain randomness in their height, the intensity of the diffraction orders varies with respect to that obtained with a perfect grating. To show this, we perform an analysis of the mutual coherence function and then, the intensity distribution at the far field is obtained. In addition to the far field diffraction orders, a "halo" that surrounds the diffraction order is found, which is due to the randomness of the strips height.

PROTECTING TRADE SECRETS IN LITIGATION - THE IMPACT OF ARTICLE 9 OF THE EU TRADE SECRET DIRECTIVE ESPECIALLY ON FINNISH LAW

In November 2013 the European Commission issued the “Proposal for a Directive on the European Parliament and of the Council on the protection of undisclosed know-how and business information (trade secrets) against their unlawful acquisition, use and disclosure” (referred to as “TSD”). The TSD offers minimum harmonisation and aims at promoting sharing of knowledge, and the exploitation of innovations on the Internal Market. The European Parliament adopted the TSD on April 14, 2016 and the EU Member States will have two years to implement it. The TSD includes a harmonised definition of a trade secret that builds on the definition provided in Article 39 of the TRIPS Agreement. Moreover, it also ensures the freedom of expression and information and the protection of whistle-blowers. Appropriate means of actions and remedies against unlawful acquisition, use and disclosure of trade secrets are also included, such as provisional and pecuniary measures, injunctions and corrective measures or allocation of damages. This study examines the protection of trade secrets in the course of litigation regulated in Article 9 of the TSD. Currently, the protection of trade secrets within the EU is fragmented especially in this regard, which makes companies reluctant to resort to litigation when a trade secret has unlawfully been misappropriated or it is suspected that a trade secret is being misused. The regulations in Article 9 expand only to the hearing in court. Such protection is welcomed and a step in the right direction. However, in my study I have found that in order for the protection to be sufficient there is a need to further establish measures to protect trade secrets during the entire process, from the filing of the claim to the end when the judgement is given. Consequently, I also discuss different measures that could be used to strengthen the protection of trade secrets before the hearing in court, as evidence are gathered.

Protecting Trade Secrets In Litigation The Impact of Article 9 of The EU Trade Secret Directive Especially on Finnish Law

In November 2013 the European Commission issued the “Proposal for a Directive on the European Parliament and of the Council on the protection of undisclosed know-how and business information (trade secrets) against their unlawful acquisition, use and disclosure” (referred to as “TSD”). The TSD offers minimum harmonisation and aims at promoting sharing of knowledge, and the exploitation of innovations on the Internal Market. The European Parliament adopted the TSD on April 14, 2016 and the EU Member States will have two years to implement it. The TSD includes a harmonised definition of a trade secret that builds on the definition provided in Article 39 of the TRIPS Agreement. Moreover, it also ensures the freedom of expression and information and the protection of whistle-blowers. Appropriate means of actions and remedies against unlawful acquisition, use and disclosure of trade secrets are also included, such as provisional and pecuniary measures, injunctions and corrective measures or allocation of damages. This study examines the protection of trade secrets in the course of litigation regulated in Article 9 of the TSD. Currently, the protection of trade secrets within the EU is fragmented especially in this regard, which makes companies reluctant to resort to litigation when a trade secret has unlawfully been misappropriated or it is suspected that a trade secret is being misused. The regulations in Article 9 expand only to the hearing in court. Such protection is welcomed and a step in the right direction. However, in my study I have found that in order for the protection to be sufficient there is a need to further establish measures to protect trade secrets during the entire process, from the filing of the claim to the end when the judgement is given. Consequently, I also discuss different measures that could be used to strengthen the protection of trade secrets before the hearing in court, as evidence are gathered.

Origin and fate of surface drift in the oceanic convergence zones of the eastern Pacific

This study investigates the structure and intensity of the surface pathways connecting to and from the central areas of the large-scale convergence regions of the eastern Pacific Ocean. Surface waters are traced with numerical Lagrangian particles transported in the velocity field of three different ocean models with horizontal resolutions that range from ¼° to 1/32°. The connections resulting from the large-scale convergent Ekman dynamics agree qualitatively but are strongly modulated by eddy variability that introduces meridional asymmetry in the amplitude of transport. Lagrangian forward-in-time integrations are used to analyze the fate of particles originating from the central regions of the convergence zones and highlight specific outflows not yet reported for the southeastern Pacific when using the currents at the highest resolutions (1/12° and 1/32°). The meridional scales of these outflows are comparable to the characteristic width of the fine-scale striation of mean currents.

Growth of the hermit crab Clibanarius vittatus (Bosc, 1802) (Crustacea, Anomura, Diogenidae) at São Vicente, São Paulo, Brazil

O presente estudo teve como objetivo analisar o crescimento de machos e fêmeas do ermitão Clibanarius vittatus (Bosc, 1802), da região de São Vicente, São Paulo, Brasil. Foram realizadas coletas mensais de maio/2001 a abril/2003, na Praia dos Pescadores em São Vicente. Os 2.501 animais capturados foram identificados, determinados quanto ao sexo e mensurados quanto ao seu comprimento de escudo cefalotorácico (CEC). Para o estudo sazonal do crescimento, a população foi dividida em classes de tamanho de 5mm de (CEC), e analisada pelo método de Bertalanffy, com o auxílio do software Fisat II. Foram obtidos 703 indivíduos machos e 1.798 fêmeas, com média de tamanho de 8.94±1.80 e 6.61±1.13mm, respectivamente. Constatou-se um padrão de crescimento sazonal, com machos atingindo um tamanho assintótico (14.92mm) superior ao das fêmeas (13.85mm), além de iniciarem o processo de crescimento aproximadamente cinco meses antes destas. Desta forma, é provável que este seja um padrão que auxilia na diminuição da disputa intra-específica por conchas, uma vez que os machos atingiram maior tamanho e estariam disponibilizando conchas menores para as fêmeas.

Study and experimental characterization of the laser welding process for the manufacturing of electric powertrain components in the automotive industry

The PhD project that will be presented in this thesis is focused on the study and optimization of the production process for the manufacturing of electrical powertrain components in the automotive field using the laser beam welding process (LBW). The objective is to define, through experimental activities, an optimized process condition for applications in the electrical field that can be generalized, that is, which guarantees its reproducibility as the types of connections vary and which represents the basis for extending the method to future applications in e-mobility sector. The work developed along two lines of research, the convergence of which made it possible to create prototypes of battery modules based on different types of lithium-ion cells and stator windings for electric motors. On the one hand, the different welding configurations involving the production of batteries based on pouch cells and therefore the welding of aluminum and copper in dissimilar configuration were studied, while for the prismatic cells only one configuration was analyzed. On the other hand, the welding of pure copper hairpins with rectangular shape in edge joint configuration was studied for the production of stator windings. The experimental tests carried out have demonstrated the feasibility of using the LBW process for the production of electric powertrain components entirely designed and developed internally as the types of materials and welding configurations vary; the methodologies required for the characterization methods, necessary for the end-of-line tests, for the evaluation of the properties of the different joint configurations and components (battery and electric motor) were also defined with the aim of obtaining the best performance. The entire doctorate program was conducted in collaboration with Ferrari Auto S.p.A. and the direct industrial application of the issues addressed has been faced.

Variation of the anal resting pressure induced by postexpiratory apnea effort in patients with constipation

CONTEXT: Intestinal constipation - a common symptom among the general population - is more frequent in women. It may be secondary to an improper diet or organic or functional disturbances, such as dyskinesia of the pelvic floor. This is basically characterized by the absence of relaxation or paradoxical contraction of the pelvic floor and anal sphincter during evacuation. OBJECTIVE: To analyze, by manometric data, the anal pressure variation at rest, during evacuation effort by using the Valsalva maneuver and forced post-expiratory apnea in subjects with secondary constipation. METHODS: Twenty-one patients (19 females - 90.4%) with a mean age of 47.5 years old (23-72) were studied. The diagnosis was performed using anorectal manometry, with a catheter containing eight channels disposed at the axial axis, measuring the proximal (1) and distal (2) portions of the anal orifice. The elevation of the pressure values in relation to the resting with the evacuation effort was present in all patients. The Agachan score was used for clinical evaluation of constipation. The variables studied were: mean anal pressure of the anal orifice for 20 seconds at rest, the effort of evacuation using Valsalva maneuver and the effort of evacuation during apnea after forced expiration, as well as the area under the curve of the manometric tracing at moments Valsalva and apnea. RESULTS: The analysis of the mean values of the anal pressure variation at rest evidenced difference between proximal and distal channels (P = 0.007), independent of the moment and tendency to differ during moments Valsalva and apnea (P = 0.06). The mean of values of the area under the manometric tracing curve showed differences between moments Valsalva and apnea (P = 0.0008), either at the proximal portion or at the distal portion of the anal orifice. CONCLUSION: The effort of evacuation associated with postexpiratory apnea, when compared with the effort associated with the Valsalva maneuver, provides lower elevation of anal pressure at rest by the parameter area under the curve.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Effects of the unilateral removal and dissection of the masseter muscle on the facial growth of young rats

This study analyzed the effects of the unilateral removal and dissection of the masseter muscle on the facial growth of young rats. A total of 30 one-month-old Wistar rats were used. Unilateral complete removal of the masseter muscle was performed in the removal group, and detachment followed by repositioning of the masseter muscle was performed in the dissection group, while only surgical access was performed in the sham-operated group. The animals were sacrificed at three months of age. Axial radiographic projections of the skulls and lateral projections of the hemimandibles were taken. Cephalometric evaluations were made and the values obtained were submitted to statistical analyses. In the removal group, there were contour alterations of the angular process, and a significant homolateral difference in the length of the maxilla and a significant bilateral difference in the height of the mandibular body and the length of the mandible were observed. Comparison among groups revealed significance only in the removal group. It was concluded that the experimental removal of the masseter muscle during the growing period in rats induced atrophic changes in the angular process, as well as asymmetry of the maxilla and shortening of the whole mandible.

The impact of the subtropical South Atlantic SST on South American precipitation

The Community Climate Model (CCM3) from the National Center for Atmospheric Research (NCAR) is used to investigate the effect of the South Atlantic sea surface temperature (SST) anomalies on interannual to decadal variability of South American precipitation. Two ensembles composed of multidecadal simulations forced with monthly SST data from the Hadley Centre for the period 1949 to 2001 are analysed. A statistical treatment based on signal-to-noise ratio and Empirical Orthogonal Functions (EOF) is applied to the ensembles in order to reduce the internal variability among the integrations. The ensemble treatment shows a spatial and temporal dependence of reproducibility. High degree of reproducibility is found in the tropics while the extratropics is apparently less reproducible. Austral autumn (MAM) and spring (SON) precipitation appears to be more reproducible over the South America-South Atlantic region than the summer (DJF) and winter (JJA) rainfall. While the Inter-tropical Convergence Zone (ITCZ) region is dominated by external variance, the South Atlantic Convergence Zone (SACZ) over South America is predominantly determined by internal variance, which makes it a difficult phenomenon to predict. Alternatively, the SACZ over western South Atlantic appears to be more sensitive to the subtropical SST anomalies than over the continent. An attempt is made to separate the atmospheric response forced by the South Atlantic SST anomalies from that associated with the El Nino - Southern Oscillation (ENSO). Results show that both the South Atlantic and Pacific SSTs modulate the intensity and position of the SACZ during DJF. Particularly, the subtropical South Atlantic SSTs are more important than ENSO in determining the position of the SACZ over the southeast Brazilian coast during DJF. On the other hand, the ENSO signal seems to influence the intensity of the SACZ not only in DJF but especially its oceanic branch during MAM. Both local and remote influences, however, are confounded by the large internal variance in the region. During MAM and JJA, the South Atlantic SST anomalies affect the magnitude and the meridional displacement of the ITCZ. In JJA, the ENSO has relatively little influence on the interannual variability of the simulated rainfall. During SON, however, the ENSO seems to counteract the effect of the subtropical South Atlantic SST variations on convection over South America.

ECAP of Fe. Experiments and simulations of the in-elbow textures

The study of deformation properties of low carbon steels is of particular interest because of their many technological applications. Obtaining fine grained Fe based materials can be approached by one of the several available Severe Plastic Deformation (SPD) techniques. The current paper shows experimental data and simulations of the deformation process of iron samples by Equal Channel Angular Extrusion (ECAE). The samples were extruded in a 120 degrees channel die either by one or a few passes. The heterogeneity and local development of the deformation on the elbow of the channel has been studied by X-ray measuring and simulation of the texture evolution. The Self Consistent models used for simulation allowed the calculation of the spin of the main texture components which agreed pretty well with the experiments.

Dynamic behavior analysis of drill-threading process when machining AISI Al-Si-Cu(4) alloy

Conventional threading operations involve two distinct machining processes: drilling and threading. Therefore, it is time consuming for the tools must be changed and the workpiece has to be moved to another machine. This paper presents an analysis of the combined process (drilling followed by threading) using a single tool for both operations: the tap-milling tool. Before presenting the methodology used to evaluate this hybrid tool, the ODS (operating deflection shapes) basics is shortly described. ODS and finite element modeling (FEM) were used during this research to optimize the process aiming to achieve higher stable machining conditions and increasing the tool life. Both methods allowed the determination of the natural frequencies and displacements of the machining center and optimize the workpiece fixture system. The results showed that there is an excellent correlation between the dynamic stability of the machining center-tool holder and the tool life, avoiding a tool premature catastrophic failure. Nevertheless, evidence showed that the tool is very sensitive to work conditions. Undoubtedly, the use of ODS and FEM eliminate empiric decisions concerning the optimization of machining conditions and increase drastically the tool life. After the ODS and FEM studies, it was possible to optimize the process and work material fixture system and machine more than 30,000 threaded holes without reaching the tool life limit and catastrophic fail.

Modeling the kinetics of the coalescence of water droplets in crude oil emulsions subject to an electric field, with the cellular automata technique

In this study, the concept of cellular automata is applied in an innovative way to simulate the separation of phases in a water/oil emulsion. The velocity of the water droplets is calculated by the balance of forces acting on a pair of droplets in a group, and cellular automata is used to simulate the whole group of droplets. Thus, it is possible to solve the problem stochastically and to show the sequence of collisions of droplets and coalescence phenomena. This methodology enables the calculation of the amount of water that can be separated from the emulsion under different operating conditions, thus enabling the process to be optimized. Comparisons between the results obtained from the developed model and the operational performance of an actual desalting unit are carried out. The accuracy observed shows that the developed model is a good representation of the actual process. (C) 2010 Published by Elsevier Ltd.