Tirantes de betão armado com varões de fibra de vidro

O aparecimento da fibra de vidro deve-se à pesquisa de novos materiais. No século XIX, as fibras de vidro foram pela primeira vez tecidas. Só mais tarde, durante o século XX, com o desenvolvimento de resinas foi possível produzir a fibra de vidro como material compósito. Ainda durante a 2ª Guerra Mundial foi construído um avião de combate em fibra de vidro. Desde então sofreu um grande desenvolvimento, tendo sido aplicada nas mais diversas indústrias. Recentemente, a fibra de vidro tem sido também aplicada em estruturas na construção civil. Nos últimos anos tem havido uma crescente investigação acerca das estruturas de betão armado com armaduras de fibra de vidro (GFRP). A análise de parâmetros como a fendilhação, a deformação e a contribuição do betão entre fendas, é fundamental para a compreensão do comportamento desse material compósito. A aderência entre os varões e o betão é condicionada pela resistência do betão e pela superfície das armaduras, podendo estas propriedades influenciarem a evolução dos parâmetros atrás referidos. Contudo, a investigação neste domínio ainda está pouco desenvolvida e carece de mais estudo, para que seja possível a sua aplicação em estruturas de uma forma mais criteriosa e abrangente. Pretendeu-se conjugar as vantagens do betão estrutural de agregados leves (BEAL), bom desempenho de resistência e a reduzida densidade, com as dos varões de GFRP, sendo necessário estudar o seu comportamento em conjunto para uma boa compreensão dos fenómenos inerentes a esta combinação de materiais. Neste trabalho analisam-se vários parâmetros fundamentais ao comportamento de elementos de BEAL reforçado com varões de GFRP, nomeadamente: a aderência da interface betão-armadura, a fendilhação, tension stiffening effect e a deformação. Para esta análise, considerou-se a variação da resistência mecânica do BEAL, do tipo de armadura de reforço (aço e GFRP) e o diâmetro dos varões. Foi desenvolvido um programa experimental que contempla um total de doze tirantes de betão armado, seis com varões de GFRP e seis com varões de aço, de forma a poder efectuar-se uma comparação directa. Foram também incluídos no programa experimental trinta e seis provetes de ensaios pull out, dezoito com armaduras de fibra de vidro e dezoito com armaduras de aço, igualmente com o objectivo de comparação dos resultados. Na análise dos resultados foi possível verificar as diferenças entre o uso de armaduras de GFRP e de aço nos parâmetros em estudo, assim como a influência da resistência dos BEAL e dos diâmetros das armaduras. Verificou-se que a largura de fendas, bem como as deformações nos tirantes com armaduras de GFRP foram superiores às observadas com armaduras de aço. No que diz respeito à aderência foram observadas menores tensões nas armaduras de GFRP.

Biossorção do corante têxtil preto reafix super 2R com bagaço de malte

Na indústria têxtil grandes volumes de efluentes são gerados, os quais são caracterizados por serem coloridos e poluentes , devido à presença de corantes em sua composição. Com a necessidade de descontaminação, diferentes métodos são utilizados no tratamento, sendo um deles, a biossorção. Este consiste na remoção das substâncias tóxicas recorrendo a biossorventes obtidos a partir de resíduos agrícolas e sub-produtos de processos industriais. O objetivo principal deste trabalho foi estudar a remoção do corante Preto Reafix Super 2R em soluções aquosas por meio de biossorção com bagaço de malte. Baseando-se sobretudo no estudo da cinética e equilíbrio entre o biossorvente e o corante. Numa primeira fase foi estudada a influência dos parâmetros operacionais, como a influência do diâmetro médio das partículas do biossorvente, o pH da solução e a velocidade de agitação da solução. Sendo as condições ótimas de biossorção definidas a pH 2, velocidade de agitação de 150 rpm e biomassa sem peneiramento. Posteriormente, ajustaram-se os modelos cinéticos de Pseudo-primeira ordem, Pseudo-segunda ordem e de Difusão intrapartícula aos resultados experimentais obtidos pela cinética de adsorção avaliando também a influência da temperatura no tempo de contato para se alcançar o equilibrio. O modelo de Pseudo-segunda ordem conduziu ao melhor ajuste, com um coeficiente de correlação (R2) de apróximadamente 1. A partir dos testes de equilíbrio realizados com diferentes concentrações de corante, foram ajustadas as isotermas de Langmuir, Freundlich, Tempkin aos resultados experimentais tendo-se obtido parâmetros bastante significativos para o modelo Langmuir, cuja capacidade máxima de remoção (qmax) obtida foi de 40,16 mg.g-1. A análise dos parâmetros termodinâmicos permitiram avaliar que o processo de adsorção ocorre espontaneamente, sendo endotérmico e que ao longo do processo aumenta a aleatoriedade na interface sólido/solução, devido à desorganização do processo em virtude das interações que ocorrem.

Filmes de nanopartículas de TiO2 e óxido de grafeno para fotocatálise

Dissertação (mestrado)—Universidade de Brasília, Instituto de Química, Programa de Pós-Graduação em Química, 2016.

Utilização de resíduo lignocelulósico na obtenção de chapa de madeira aglomerada homogênea e compósito reforçado com fibra de vidro-E

This research is about the use of the coconut´s endocarp (nucifera linn) and the waste of derivatives of wood and furniture as raw material to technological use. In that sense, the lignocellulosic waste is used for manufacture of homogeneous wood sheet agglomerate (LHWS) and lignocellulosic load which take part of a polymeric composite with fiber glass E (GFRP-WC). In the manufacturing of the homogeneous wood sheet agglomerate (LHWS), it was used mamona´s resin as waste s agglutinating element. The plates were taken up in a hydraulic press engine, heated, with temperature control, where they were manufactured for different percentage of waste wood and coconuts nucífera linn. Physical tests were conducted to determine the absorption of water, density, damp grade (in two hours and twenty-four hours), swelling thickness (in two hours and twenty-four hours), and mechanical tests to evaluate the parallel tensile strength (internal stick) and bending and the static (steady) flexural. The physical test´s results indicate that the LHWS can be classified as bonded wood plate of high-density and with highly water resistant. In the mechanical tests it was possible to establish that LHWS presents different characteristics when submitted to uniaxial tensile and to the static (steady) flexural, since brittle and elasticity module had a variation according to the amount of dry endocarp used to manufacture each trace of LHWS. The GFRP-WC was industrially manufactured by a hand-lay-up process where the fiber glass E was used as reinforcement the lignocellulósic´s waste as load. The matrix was made with ortofitalic unsaturated polyester resin. Physical and mechanical tests were performed in presence of saturated humidity and dry. The results indicated good performance of the GFRP-WC, as traction as in flexion in three points. The presence of water influenced the modules obtained in the flexural and tensile but there were no significant alteration in the properties analyzed. As for the fracture, the analysis showed that the effects are more harmful in the presence of damp, under the action of loading tested, but despite this, the fracture was well defined starting in the external parts and spreading to the internal regions when one when it reaches the hybrid load

Avaliação de concretos reforçados por confinamento com manta de fibra de vidro estrutural e pré-impreganada

Due to the occurrence of diseases in the use of structural reinforcements in composites, with presentation of concrete blanket detachment, has been identified the need to evaluate the performance of concrete reinforced with glass fiber. This study aims to evaluate these concretes by means of testing methodologies, using concrete with low resistance with structural reinforcement for confinement by preimpregnated glass fiber and traditional fiberglass blanket. The first stage of work was the development of methodologies for analysis, opting for four types, such as the acoustic survey, strength to compressive, the pull-off and ultrasound. Next, tests were carried out using the four selected methodologies in 30 of proof-of-specimens by 5x10 cm, 15 were reinforced with the traditional fiberglass blanket with 5specimens exposed to test a marine environment of marine coastline of Natal-RN and 15 were reinforced with a pre-impregnated glass fiber blanket, as well as 5specimens exposed to a test environment of the marine coastline of Natal-RN. After conducting the acoustic survey, it has been verified a lack of delaminating and air bubbles in the samples, confirming the absence of gross shortcomings in the implementation of the ribs both the traditional fiberglass blanket and in the preimpregnated fiber glass blanket. After carrying out methods of pull-off and compressive strengthening test it was observed that the reinforced proof-bodies with pre-impregnated glass blanket showed maximum stresses higher than the traditional fiberglass blanket; consequently a greater grip with the formation of a smaller area of . fracture, unlike traditional glass mat, which showed lower maximum stresses, with a greater area of fracture. It was also found that the traditional fiberglass blanket presented detachment of blanket-concrete interface, unlike the pre-impregnated fiberglass blanket, which showed a better grip on the blanket-concrete interface. In the trial of ultrasound there was no presence of cracks in the blanket-concrete interface, yielding to both blankets good compactness of the concrete. At the end of this work, they were developed and proposed two methods of testing for evaluation of reinforced concrete structures with composites, for standardization, the acoustic survey and pull-off

Desenvolvimento e caracterização de compósitos poli(tereftalato de etileno) reciclado (PET reciclado) com flocos de vidro.

The growing concern with the solid residues management, observed in the last decade, due to its huge amount and impact, has motivated the search for recycling processes, where these residues can be reprocessed to generate new products, enlarging the cycle of materials and energy which are present. Among the polymeric residues, there is poly (ethylene terephthalate) (PET). PET is used in food packaging, preferably in the bottling of carbonated beverages. The reintegration of post-consumer PET in half can be considered a productive action mitigation of environmental impacts caused by these wastes and it is done through the preparation of several different products at the origin, i.e. food packaging, with recycling rates increasing to each year. This work focused on the development and characterization mechanical, thermal, thermo-mechanical, dynamic mechanical thermal and morphology of the pure recycled PET and recycled PET composites with glass flakes in the weight fraction of 5%, 10% and 20% processed in a single screw extruder, using the following analytical techniques: thermogravimetry (TG), differential scanning calorimetry (DSC), tensile, Izod impact, Rockwell hardness, Vicat softening temperature, melt flow rate, burn rate, dynamic mechanical thermal analysis (DMTA) and scanning electron microscopy (SEM). The results of thermal analysis and mechanical properties leading to a positive evaluation, because in the thermograms the addition of glass flakes showed increasing behavior in the initial temperatures of thermal decomposition and melting crystalline, Furthermore was observed growing behavior in the mechanical performance of polymer composites, whose morphological structure was observed by SEM, verifying a good distribution of glass flakes, showing difference orientation in the center and in the surface layer of test body of composites with 10 and 20% of glass flakes. The results of DMTA Tg values of the composites obtained from the peak of tan ä showed little reductions due to poor interfacial adhesion between PET and recycled glass flakes.

Fachadas ventiladas. Avaliação de sistema de camada de vidro duplo ventilado

Dissertação de Mestrado, Energias Renováveis e Gestão de Energia, Faculdade de Ciências e Tecnologia, Universidade do Algarve, 2014

Influência do tipo de vidro de cobertura na produtividade do tomate em estufa

Mestrado em Engenharia Agronómica - Hortofruticultura e Viticultura - Instituto Superior de Agronomia - UL

Estudo comparativo de pás para aerogeradores de grande porte fabricadas em materiais compósitos reforçadas com fibra de carbono ou fibra de vidro

The research and development of wind turbine blades are essential to keep pace with worldwide growth in the renewable energy sector. Although currently blades are typically produced using glass fiber reinforced composite materials, the tendency for larger size blades, particularly for offshore applications, has increased the interest on carbon fiber reinforced composites because of the potential for increased stiffness and weight reduction. In this study a model of blade designed for large generators (5 MW) was studied on a small scale. A numerical simulation was performed to determine the aerodynamic loading using a Computational Fluid Dynamics (CFD) software. Two blades were then designed and manufactured using epoxy matrix composites: one reinforced with glass fibers and the other with carbon fibers. For the structural calculations, maximum stress failure criterion was adopted. The blades were manufactured by Vacuum Assisted Resin Transfer Molding (VARTM), typical for this type of component. A weight comparison of the two blades was performed and the weight of the carbon fiber blade was approximately 45% of the weight of the fiberglass reinforced blade. Static bending tests were carried out on the blades for various percentages of the design load and deflections measurements were compared with the values obtained from finite element simulations. A good agreement was observed between the measured and calculated deflections. In summary, the results of this study confirm that the low density combined with high mechanical properties of carbon fibers are particularly attractive for the production of large size wind turbine blades

Efeito da adição de microfibras de lã de vidro na tenacidade à ruptura de pastas de cimento para poços de petróleo

Although there are a wide variety of additives that act in fresh state, to adjust the properties of cement, there is also a search by additions that improve the tenacity of the cement in the hardened state. This, in turn, can often be increased by inserting fibers, which act on the deflection of microcracks. This study aimed to use a microfiber glass wool (silica-based) as an additive reinforcing the cement matrix, improving the rupture tenacity, in order to prevent the propagation of microcracks in the cement sheath commonly found in oil wells submitted to high temperatures. The fibers were added at different concentrations, 2 to 5% (BWOC) and varied average sizes, grinding for 90 s, 180 s, 300 s, 600 s. The cement slurries were made with a density of 1,90 g/ cm3 (15,6 lb/gal), using Portland cement CPP- Special Class as the hydraulic binder and 40% silica flour. The characterization of the fiber was made by scanning electron microscopy (SEM), particle size by sieving, X-ray fluorescence (XRF), X-ray diffraction (XRD) and thermogravimetry (TG / DTG). Were performed technological tests set by the API (American Petroleum Institute) by rheology, stability, free water, compressive strength, as well as testing rupture energy, elastic modulus and permeability. The characterization results showed good thermal stability of the microfiber glass wool for application in oil wells submitted to steam injection and, also, that from the particle size data, it was possible to suggest that microfibers milled up to 300 s, are ideal to act as reinforcement to the cement slurries. The rheological parameters, there was committal of plastic viscosity when larger lengths were inserted of microfiber (F90). The values obtained by free water and stability were presented according to API. The mechanical properties, the incorporation of microfiber to the cement slurries gave better rupture tenacity, as compared to reference cement slurries. The values of compressive strength, elastic modulus and permeability have been maintained with respect to the reference cement slurries. Thus, cement slurries reinforced with microfiber glass wool can ensure good application for cementing oil wells submitted to steam injection, which requires control of microcracks, due to the thermal gradients

“Ressonância num copo de vidro” - Experiência (vídeo de 4 min 46 s, Graça Carraça, Departamento de Física, Escola de Ciências e Tecnologia- Universidade de Évora).

“Ressonância num copo de vidro” - Experiência (vídeo de 4 min 46 s, Graça Carraça, Departamento de Física, Escola de Ciências e Tecnologia- Universidade de Évora). A experiência sobre Ressonância num copo de vidro registada neste vídeo faz parte de um conjunto de trabalhos de divulgação, seleccionados de entre os vários disponíveis no Departamento de Física e que podem ser explorados de uma forma mais avançada nas nossas aulas. Parte deste trabalho experimental (a que não envolve luz estroboscópica) foi recentemente apresentada como actividade interactiva a um público muito jovem, crianças dos 7 aos 12 anos, do Campo de Férias SASUE - 2016, integrada no tema “Explorando o som”. A experiência suscitou muita curiosidade e o interesse sobre a explicação dos fenómenos físicos em causa, havendo um entusiasmo acrescido por terem tido a possibilidade de experimentarem eles próprios algumas partes do trabalho. Com este registo em vídeo pretende-se facilitar o trabalho de alunos e professores que queiram realizar a experiência, assim como suscitar o seu interesse para a exploração do tema.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Fluoride release profile of a nanofilled resin-modified glass ionomer cement

The present study aimed to compare the fluoride (F-) release pattern of a nanofilled resin-modified glass ionomer cement (GIC) (Ketac N100 - KN) with available GICs used in dental practice (resin-modified GIC - Vitremer - V; conventional GIC - Ketac Molar - KM) and a nanofilled resin composite (Filtek Supreme - RC). Discs of each material (n=6) were placed into 4 mL of deionized water in sealed polyethylene vials and shaken, for 15 days. F- release (μg F-/cm²) was measured each day using a fluoride-ion specific electrode. Cumulative F- release means were statistically analyzed by linear regression analysis. In order to analyze the differences among materials and the influence of time in the daily F- release, 2-way ANOVA test was performed (α=0.05). The linear fits between the cumulative F- release profiles of RC and KM and time were weak. KN and V presented a strong relationship between cumulative F- release and time. There were significant differences between the daily F- release overtime up to the third day only for GICs materials. The daily F- release means for RC were similar overtime. The results indicate that the F- release profile of the nanofilled resin-modified GIC is comparable to the resin-modified GIC.