1000 resultados para Condição edafoclimático


Relevância:

20.00% 20.00%

Publicador:

Resumo:

FUNDAMENTOS: O aumento da expectativa de vida no Brasil e nos diversos países do mundo é um fenômeno bem estabelecido, em razão dos avanços dos estudos no campo da Saúde e da melhora da qualidade de vida. E tal mudança é acompanhada de grande necessidade de reabilitação protética devido ao alto percentual de idosos edêntulos. OBJETIVO: Avaliar a situação da saúde bucal de pessoas com mais de 60 anos, não-institucionalizadas, usuárias de uma unidade de saúde da Secretaria Municipal de Saúde de Ribeirão das Neves - Minas Gerais. METODOLOGIA: Trata-se de uma pesquisa transversal, realizada por meio da análise do odontograma de 50 pacientes atendidos na Unidade de Referência Odontológica (URO) Veredas do município no ano de 2009, num intervalo de três meses. RESULTADOS: Pôde-se perceber alto índice CPO-D médio (28,47) e também de necessidades de prótese dentária total removível (80) entre os idosos avaliados. CONCLUSÃO: Os resultados deste estudo mostraram que o edentulismo é um problema de saúde pública para o qual, inicialmente, devem-se adotar critérios de priorização na implantação do serviço na atenção básica.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este trabalho é um estudo de revisão literária integrativa de artigos científicos, pesquisados nas bases de dados eletrônicos, LILACS, MEDLINE e SciELO, encontrados no site da Biblioteca Virtual em Saúde (BIREME), relacionados às práticas de promoção e prevenção em saúde bucal em adultos e idosos, com o intuito de conhecê-las e de verificar o seu impacto na melhoria das condições bucais desses indivíduos, por meio de mudanças comportamentais e culturais. Através desse estudo buscou-se elaborar um Plano de Intervenção, identificando estratégias capazes de enfrentar o problema da precária saúde bucal dos adultos e idosos da área de abrangência da ESF Santo Antônio no município de Patrocínio-MG, visando atingir e modificar hábitos há muito arraigados, promovendo assim uma transformação na realidade da saúde bucal desses grupos, melhorando a sua qualidade de vida por meio de um sorriso saudável. O estudo foi de real importância no processo de conhecimento e de amadurecimento da autora, sendo um norteador de ideias e um instrumento facilitador na formulação das estratégias, uma vez que abriu os horizontes do pensamento ampliando a visão sobre o problema enfrentado.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A saúde bucal dos idosos foi caracterizada nos inquéritos de saúde bucal realizados no Brasil em 2003 e 2010 nos quais os números de edentulismo e doença periodontal foram altos. Estas condições indicam a ineficácia e a ineficiência de políticas de saúde bucal passadas onde os idosos e os adultos eram excluídos. O presente estudo objetiva propor um plano de intervenção para melhorar as condições bucais dos idosos adscritos na área de abrangência da equipe de saúde Renascer do município de Diamantina. Foi feito uma revisão bibliográfica sobre o tema saúde bucal do idoso e a busca dos artigos foi realizada por meio de descritores. Os autores pesquisados destacaram a preocupação com a saúde bucal dos idosos e a importância de programas que visam melhorar a qualidade de vida dessa população. Foi elaborado um plano de intervenção tendo como modelo o proposto por Cardoso; Faria e Santos (2010). Para tal, foram identificados os principais problemas que afetam a população bem como suas causas de onde foi estabelecido um modelo de intervenção. Espera-se com isto, diminuir as infecções bucais, promover saúde, e resolver os problemas relacionados à acessibilidade para a população de idosos da Estratégia de Saúde da Família Renascer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Inulin is a fructooligosacharide found in diverse agricultural products, amongst them garlic, banana, Jerusalem artichoke and chicory root. Inulin generally is used in developed countries, as a substitute of sugar and/or fat due to its characteristics of fitting as functional and dietary food. Chicory root is usually used as source and raw material for commercial extration of inulin. The experiments consisted on drying sliced chicory roots based on a factorial experimental design in a convective dryer whose alows the air to pass perpendicularly through the tray. Effective diffusivity (dependent variable) has been determined for each experimental combination of independent variables (air temperature and velocity). The data curves have been fitted by the solution of the second Fick law and Page's model. Effective difusivity varied from 3.51 x 10-10 m² s-1 to 1.036 x 10-10 m² s-1. It is concluded that, for the range of studied values, air temperature is the only statistically significant variable. So, a first order mathematical model was obtained, representing effective diffusivity behavior as function of air temperature. The best drying condition was correspondent to the trial using the highest drying air temperature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The swine breeder rearing environment directly affects the animal's performance. This research had the objective of developing a thermal, aerial and acoustic environmental evaluation pattern for boar housing. The experiment was carried on a commercial swine farm in Salto County -SP, Brazil. Thermal, aerial and acoustic environment data of rearing conditions were registered. Data were statistically analyzed using as threshold the ideal housing environment that leads to animal welfare. Results showed that ambient temperature was around 70% beyond normal range, while air relative humidity, air speed and gases concentration were within threshold values. Noise level data besides being within normal range did not present large variation. In relation to the fuzzy logic analysis it was possible to build up a scenario which indicated that the best welfare indexes to male swine breeders happens when thermal comfort index are close to 80%, and noise level is lower than 40 dB. In the other hand the worst welfare index occur in the sector where the thermal comfort values are below 40% at the same time that the noise level is higher than 80 dB leading to inadequate conditions to the animal, and may directly interfere in the reproduction system performance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Epilepsy is a common chronic condition in the childhood and its diagnosis reveals psychological, social and family difficulties, that seem to be related with beliefs and quality of parents-children interaction. The purpose of this paper is to schematize investigation strategies for the psychological variables: beliefs, impact of the disease, family relationship, identification of changes. Based upon collected reports of epileptic children's parents and upon surveyed aspects of the literature, psychological questionnaires were elaborated to identify important variables that affect the child's epilepsy life and his family. The use of more appropriate investigation procedures facilitates the psychological evaluation and ensures the collection of data.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this paper I present some evidencie that forces us to conclude that within the Minimalist Program (Chomsky 1993; 1995), Binding Theory (BT) should be computed after LF (Logical Form). I show that derivations leading to structures containing violations of BT-Principles must converge at LF, since less economical alternative derivations respecting those principles are also ungrammatical. Being irrelevant to the notion of convergence, BT must apply after LF. A similar reasoning reveals that the Theta-Criterion should have the status of a bare output condition appling at LF, since less economical derivations are allowed by the computational system to prevent violations of it.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The theme of human formation is at the centre of the philosophy of education, whose aim is precisely the process of human promotion brought about by education. Starting from the critical vigilance proper to philosophy, the text sketches a phenomenology of the present time, verifying that the ideas prevailing in education at present are centred on the critique of reason and on the notions of truth and objectivity. This neo-pragmatism, which in the attempt to oppose metaphysics becomes deeply metaphysical, reducing everything to language, is contested by the authors with Marx's thoughts as a historicising philosophy that concerns not abstract subjects, but real individuals, historical subjects that are constituted as a synthesis of social relations. To that end, the authors resort to the historical ontological reflection on human formation contained in Marx's Economic and Philosophical Manuscripts of 1844. The article concludes by defending the proposition that access to the classics is a necessary condition for human formation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Armies from all over the world acknowledge the importance of good physical fitness for the performance of military duties. The Military Exercise Training (MET) attempts to provide assistance to this search for better physical fitness and performance. OBJECTIVE: To verifying the effect on the body composition and physical performance of the students at ESPCEX (Military School for Preparation of Army Cadets) after 13 weeks of MET. METHODS: The sample was formed by 287 male students from the ESPCEX, whose average age was 18.33 ±1.26. Such students accomplished a boarding school routine, having defined schedules, meals and activities from which they were only released during the weekends. The MET was accomplished five days a week and it comprised both aerobic and resistance training. Measurement of body mass, height, skinfold (triceps, abdominal and suprailiac) was accomplished during pre and post training periods, and the following tests were performed: 12-minutes-run, oblique sit up, arm push up and pull up. Fat percentage, fat-free body mass and fat body mass were calculated using the anthropometric data based on the Guedes 3 skinfold protocol. RESULTS: Significant reduction in fat body mass, fat percentage and in triceptal and abdominal skinfold, as well as increase in suprailiac skinfold and fat-free body mass was observed when anthropometric and body composition data were compared, during the initial and the final periods of training. Significant improvement also occurred in all prformed physical tests, in which better performance was achieved. CONCLUSION: The acquired data suggest that performance of MET 5 days a week brought significantly improved body composition as well as physical performance

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article considers a procedure for data collection called autoscopy. Autoscopy entails the video recording of a practice with the purpose of allowing analysis and self-evaluation by one of the protagonists of that practice. The objective of the video recording is that of apprehending the actions of the agent (or agents), the scenario, and the plot that make up a situation. The recorded material is subjected to sessions of analysis after the action that aim at the understanding of the reflective process of the agent (or agents) through their verbalizations during the analysis of video recorded scenes. The present text introduces a theoretical basis for the procedure of autoscopy, deals with advantages and limitations of its use, as well as with aspects that deserve attention and, finally, describes the authors' experiences in two studies in which the procedure was employed. Starting from these two experiences, differences and similarities are pointed out between the studies, especially regarding the participants, object, and the time distribution of the video recordings. The authors draw considerations about the formative-reflective potential of the procedure, both for research situations and for the learning and training of various professionals, considering it to be an excellent educational instrument. It is, however, vital to keep in mind the need to recognize and return to the teacher, as an autoscopic participant, his condition as subject of his own profession, thereby promoting, besides the self-evaluation, also the autonomy of his thinking and doing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Paracoccidioidomycosis is the most frequent systemic mycosis in Brazil, but ocular involvement is rare and, if present, often secondary to another site. The authors report a case of paracoccidioidomycosis of eyelid and conjunctiva where no extraocular focus was found. A brief review of the literature is made discussing the importance of diagnostic suspecion in a population at risk and early treatment for a good visual prognosis.