998 resultados para Arthur, Chester Alan (1830-1886) -- Portraits


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

RESUMO: Analisamos neste artigo a teoria do conhecimento de Arthur Schopenhauer com base em sua dissertação Sobre a quádrupla raiz do princípio de razão suficiente (1813), seu ensaio Sobre a visão e as cores (1816), os dois primeiros livros de O mundo como vontade e representação (1819), bem como o apêndice a esta obra intitulado Crítica da filosofia kantiana. Aqui temos em mente a relação de Schopenhauer com as filosofias anteriores (em especial a de Kant) e a fundamentação de sua intuição do mundo como Vontade baseada em uma epistemologia de raízes kantianas.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The intention of this paper is to analyze the letters from Capistrano de Abreu to Barao do Rio Branco in the years between 1886 and 1903. The focus will be given to the divergences around the notion of territorial formation, a basic concept for these authors who were thinking about the construction of a historical narrative at the end of the 19(th) and beginning of the 20(th) century. Later, the question is the construction of the craft of the historian in the letters of Capistrano de Abreu and his distinction and proximity to the ideas of the Barao do Rio Branco.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: A limited number of mutations in the GH secretagogue receptor gene (GHSR) have been described in patients with short stature. Objective: To analyze GHSR in idiopathic short stature (ISS) children including a subgroup of constitutional delay of growth and puberty (CDGP) patients. Subjects and methods: The GHSR coding region was directly sequenced in 96 independent patients with ISS, 31 of them with CDGP, in 150 adults, and in 197 children with normal stature. The pharmacological consequences of GHSR non-synonymous variations were established using in vitro cell-based assays. Results: Five different heterozygous point variations in GHSR were identified (c.-6 G>C, c.251G>T (p.Ser84Ile), c.505G>A (p.Ala169Thr), c.545 T>C (p.Val182Ala), and c.1072G>A (p.Ala358Thr)), all in patients with CDGP. Neither these allelic variants nor any other mutations were found in 694 alleles from controls. Functional studies revealed that two of these variations (p.Ser84Ile and p. Val182Ala) result in a decrease in basal activity that was in part explained by a reduction in cell surface expression. The p.Ser84Ile mutation was also associated with a defect in ghrelin potency. These mutations were identified in two female patients with CDGP (at the age of 13 years, their height SDS were -2.4 and -2.3). Both patients had normal progression of puberty and reached normal adult height (height SDS of -0.7 and -1.4) without treatment. Conclusion: This is the first report of GHSR mutations in patients with CDGP. Our data raise the intriguing possibility that abnormalities in ghrelin receptor function may influence the phenotype of individuals with CDGP.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ribeiro Arthur foi militar, crítico de Arte e foi sobretudo um dos mais importantes investigadores e ilustradores da história dos uniformes em Portugal. Produziu um número muito significativo de aguarelas dedicadas a este tema que, reunidas em colecção, estão preservadas no Arquivo Histórico Militar. ABSTRACT - Artur Ribeiro Arthur was military, art critic and was one of the most important researchers and illustrators in the history of the uniforms in Portugal. He produced a significant number of watercolors dedicated to this theme, gathered in collections that are kept in the Military Historical Archive.