Environmental assessment of industrial chemical and primary sector processes from a life cycle perspective

During the PhD program in chemistry at the University of Bologna, the environmental sustainability of some industrial processes was studied through the application of the LCA methodology. The efforts were focused on the study of processes under development, in order to assess their environmental impacts to guide their transfer on an industrial scale. Processes that could meet the principles of Green Chemistry have been selected and their environmental benefits have been evaluated through a holistic approach. The use of renewable sources was assessed through the study of terephthalic acid production from biomass (which showed that only the use of waste can provide an environmental benefit) and a new process for biogas upgrading (whose potential is to act as a carbon capture technology). Furthermore, the basis for the development of a new methodology for the prediction of the environmental impact of ionic liquids has been laid. It has already shown good qualities in identifying impact trends, but further research on it is needed to obtain a more reliable and usable model. In the context of sustainable development that will not only be sector-specific, the environmental performance of some processes linked to the primary production sector has also been evaluated. The impacts of some organic farming practices in the wine production were analysed, the use of the Cereal Unit parameter was proposed as a functional unit for the comparison of different crop rotations, and the carbon footprint of school canteen meals was calculated. The results of the analyses confirm that sustainability in the industrial production sector should be assessed from a life cycle perspective, in order to consider all the flows involved during the different phases. In particular, it is necessary that environmental assessments adopt a cradle-to-gate approach, to avoid shifting the environmental burden from one phase to another.

Life Cycle Thinking for sustainability assessment and decision-making in selected food supply chains in Costa Rica

The Agenda 2030 contains 17 integrated Sustainable Development Goals (SDGs). SDG 12 for Sustainable Consumption and Production (SCP) promotes the efficient use of resources through a systemic change that decouples economic growth from environmental degradation. The Food Systems (FS) pillar in SDG 12 entails paramount relevance due to its interconnection to many other SDGs, and even when being a crucial world food supplier, the Latin American and Caribbean (LAC) Region struggles with environmental and social externalities, low investment in agriculture, inequity, food insecurity, poverty, and migration. Life Cycle Thinking (LCT) was regarded as a pertinent approach to identify hotspots and trade-offs, and support decision-making process to aid LAC Region countries as Costa Rica to diagnose sustainability and overcome certain challenges. This thesis aimed to ‘evaluate the sustainability of selected products from food supply chains in Costa Rica, to provide inputs for further sustainable decision-making, through the application of Life Cycle Thinking’. To do this, Life Cycle Assessment (LCA), Life Cycle Costing (LCC), and Social Life Cycle Assessment (S-LCA) evaluated the sustainability of food-waste-to-energy alternatives, and the production of green coffee, raw milk and leafy vegetables, and identified environmental, social and cost hotspots. This approach also proved to be a useful component of decision-making and policy-making processes together with other methods. LCT scientific literature led by LAC or Costa Rican researchers is still scarce; therefore, this research contributed to improve capacities in the use of LCT in this context, while offering potential replicability of the developed frameworks in similar cases. Main limitations related to the representativeness and availability of primary data; however, future research and extension activities are foreseen to increase local data availability, capacity building, and the discussion of potential integration through Life Cycle Sustainability Assessment (LCSA).

Dry grinding technology for automotive gears manufacturing: process modeling and optimization

The following thesis focused on the dry grinding process modelling and optimization for automotive gears production. A FEM model was implemented with the aim at predicting process temperatures and preventing grinding thermal defects on the material surface. In particular, the model was conceived to facilitate the choice of the grinding parameters during the design and the execution of the dry-hard finishing process developed and patented by the company Samputensili Machine Tools (EMAG Group) on automotive gears. The proposed model allows to analyse the influence of the technological parameters, comprising the grinding wheel specifications. Automotive gears finished by dry-hard finishing process are supposed to reach the same quality target of the gears finished through the conventional wet grinding process with the advantage of reducing production costs and environmental pollution. But, the grinding process allows very high values of specific pressure and heat absorbed by the material, therefore, removing the lubricant increases the risk of thermal defects occurrence. An incorrect design of the process parameters set could cause grinding burns, which affect the mechanical performance of the ground component inevitably. Therefore, a modelling phase of the process could allow to enhance the mechanical characteristics of the components and avoid waste during production. A hierarchical FEM model was implemented to predict dry grinding temperatures and was represented by the interconnection of a microscopic and a macroscopic approach. A microscopic single grain grinding model was linked to a macroscopic thermal model to predict the dry grinding process temperatures and so to forecast the thermal cycle effect caused by the process parameters and the grinding wheel specification choice. Good agreement between the model and the experiments was achieved making the dry-hard finishing an efficient and reliable technology to implement in the gears automotive industry.

Computer vision in aseptic pharmaceutical manufacturing: a deep learning-based approach to vial inspection and pack formation during a lyophilizer loading cycle

Vision systems are powerful tools playing an increasingly important role in modern industry, to detect errors and maintain product standards. With the enlarged availability of affordable industrial cameras, computer vision algorithms have been increasingly applied in industrial manufacturing processes monitoring. Until a few years ago, industrial computer vision applications relied only on ad-hoc algorithms designed for the specific object and acquisition setup being monitored, with a strong focus on co-designing the acquisition and processing pipeline. Deep learning has overcome these limits providing greater flexibility and faster re-configuration. In this work, the process to be inspected consists in vials’ pack formation entering a freeze-dryer, which is a common scenario in pharmaceutical active ingredient packaging lines. To ensure that the machine produces proper packs, a vision system is installed at the entrance of the freeze-dryer to detect eventual anomalies with execution times compatible with the production specifications. Other constraints come from sterility and safety standards required in pharmaceutical manufacturing. This work presents an overview about the production line, with particular focus on the vision system designed, and about all trials conducted to obtain the final performance. Transfer learning, alleviating the requirement for a large number of training data, combined with data augmentation methods, consisting in the generation of synthetic images, were used to effectively increase the performances while reducing the cost of data acquisition and annotation. The proposed vision algorithm is composed by two main subtasks, designed respectively to vials counting and discrepancy detection. The first one was trained on more than 23k vials (about 300 images) and tested on 5k more (about 75 images), whereas 60 training images and 52 testing images were used for the second one.

Cure Induced Residual Stresses on Thick Composite Components Manufactured by Additive Process

This study investigates the effect of an additive process in manufacturing of thick composites. Airstone 780 E epoxy resin and 785H Hardener system is used in the analysis since it is widely used wind turbine blade, namely thick components. As a fiber, fabric by SAERTEX (812 g/m2) with a 0-90 degrees layup direction is used. Temperature overshoot is a major issue during the manufacturing of thick composites. A high temperature overshoot leads to an increase in residual stresses. These residual stresses are causing warping, delamination, dimensional instability, and undesired distortion of composite structures. A coupled thermo-mechanical model capable of predicting cure induced residual stresses have been built using the commercial FE software Abaqus®. The possibility of building thick composite components by means of adding a finite number of sub-laminates has been investigated. The results have been compared against components manufactured following a standard route. The influence of pre-curing of the sub-laminates has also been addressed and results compared with standard practice. As a result of the study, it is found that introducing additive process can prevent temperature overshoot to occur and benefits the residual stresses generation during the curing process. However, the process time required increases by 50%, therefore increasing the manufacturing costs. An optimized cure cycle is required to minimize process time and cure induced defects simultaneously.

Towards the sustainable production of methyl methacrylate: A comparative analysis of industrial chemical production processes using life cycle assessment methodology

Increasing environmental awareness has been a significant driving force for innovations and process improvements in different sectors and the field of chemistry is not an outlier. Innovating around industrial chemical processes in line with current environmental responsibilities is however no mean feat. One of such hard to overhaul process is the production of methyl methacrylate (MMA) commonly produced via the acetone cyanohydrin (ACH) process developed back in the 1930s. Different alternatives to the ACH process have emerged over the years and the Alpha Lucite process has been particularly promising with a combined plant capacity of 370,000 metric tonnes in Singapore and Saudi Arabia. This study applied Life Cycle Assessment methodology to conduct a comparative analysis between the ACH and Lucite processes with the aim of ascertaining the effect of applying principles of green chemistry as a process improvement tool on overall environmental impacts. A further comparison was made between the Lucite process and a lab-scale process that is further improvement on the former, also based on green chemistry principles. Results showed that the Lucite process has higher impacts on resource scarcity and ecosystem health whereas the ACH process has higher impacts on human health. On the other hand, compared to the Lucite process the lab-scale process has higher impacts in both the ecosystem and human health categories with lower impacts only in the resource scarcity category. It was observed that the benefits of process improvements with green chemistry principles might not be apparent in some categories due to some limitations of the methodology. Process contribution analysis was also performed and it revealed that the contribution of energy is significant, therefore a sensitivity analysis with different energy scenarios was performed. An uncertainty analysis using Monte Carlo analysis was also performed to validate the consistency of the results in each of the comparisons.

Life cycle assessment (lca) of six separation methods of polyethylene and aluminum in tetra pak

In food and beverage industry, packaging plays a crucial role in protecting food and beverages and maintaining their organoleptic properties. Their disposal, unfortunately, is still difficult, mainly because there is a lack of economically viable systems for separating composite and multilayer materials. It is therefore necessary not only to increase research in this area, but also to set up pilot plants and implement these technologies on an industrial scale. LCA (Life Cycle Assessment) can fulfil these purposes. It allows an assessment of the potential environmental impacts associated with a product, service or process. The objective of this thesis work is to analyze the environmental performance of six separation methods, designed for separating the polymeric from the aluminum fraction in multilayered packaging. The first four methods utilize the chemical dissolution technique using Biodiesel, Cyclohexane, 2-Methyltetrahydrofuran (2-MeTHF) and Cyclopentyl-methyl-ether (CPME) as solvents. The last two applied the mechanical delamination technique with surfactant-activated water, using Ammonium laurate and Triethanolamine laurate as surfactants, respectively. For all six methods, the LCA methodology was applied and the corresponding models were built with the GaBi software version 10.6.2.9, specifically for LCA analyses. Unfortunately, due to a lack of data, it was not possible to obtain the results of the dissolution methods with the solvents 2-MeTHF and CPME; for the other methods, however, the individual environmental performances were calculated. Results revealed that the methods with the best environmental performance are method 2, for dissolution methods, and method 5, for delamination methods. This result is confirmed both by the analysis of normalized and weighted results and by the analysis of 'original' results. An hotspots analysis was also conducted.

Interplay Between Cell Growth And Cell Cycle In Plants.

The growth of organs and whole plants depends on both cell growth and cell-cycle progression, but the interaction between both processes is poorly understood. In plants, the balance between growth and cell-cycle progression requires coordinated regulation of four different processes: macromolecular synthesis (cytoplasmic growth), turgor-driven cell-wall extension, mitotic cycle, and endocycle. Potential feedbacks between these processes include a cell-size checkpoint operating before DNA synthesis and a link between DNA contents and maximum cell size. In addition, key intercellular signals and growth regulatory genes appear to target at the same time cell-cycle and cell-growth functions. For example, auxin, gibberellin, and brassinosteroid all have parallel links to cell-cycle progression (through S-phase Cyclin D-CDK and the anaphase-promoting complex) and cell-wall functions (through cell-wall extensibility or microtubule dynamics). Another intercellular signal mediated by microtubule dynamics is the mechanical stress caused by growth of interconnected cells. Superimposed on developmental controls, sugar signalling through the TOR pathway has recently emerged as a central control point linking cytoplasmic growth, cell-cycle and cell-wall functions. Recent progress in quantitative imaging and computational modelling will facilitate analysis of the multiple interconnections between plant cell growth and cell cycle and ultimately will be required for the predictive manipulation of plant growth.

Screening The Life Cycle Of Schistosoma Mansoni Using High-resolution Mass Spectrometry.

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Polymorphisms Of Cell Cycle Control Genes Influence The Development Of Sporadic Medullary Thyroid Carcinoma.

The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.

[in Process Citation].

20

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física