Understanding and Managing the Late Time of Ratooning Effect on Cane Yield

Each year growers are faced with the decision of when to harvest individual blocks of sugarcane throughout the harvest season. This decision influences the yield of the current crop and can affect the yield in the following season. Growers must therefore decide which blocks to harvest early and which to harvest later in the harvest season. Usually, the latest harvested cane is the lowest yielding the following year (the �late harvest� effect). Block productivity data from Tully were used to determine the effects of harvest timing on cane yield of the current and subsequent crop. The results are tabulated to provide a ready reference to these time of harvest effects on the current and future crop in either a single year or over the full crop cycle for the Tully district.

Sugar and coffee: A history of settler agriculture in nineteenth-century Liberia

This dissertation is about commercial agriculture in nineteenth-century Liberia. Based primarily on the archives of the American Colonization Society (founder of Liberia), it examines the impact of environmental and demographic constraints on an agrarian settler society from 1822 to the 1890s. Contrary to the standard interpretation, which linked the poor state of commercial agriculture to the settlers' disdain for cultivation, this dissertation argues that the scarcity of labor and capital impeded the growth of commercial agriculture. The causes of the scarcity were high mortality, low immigration and the poverty of the American “Negroes” who began to settle Liberia in 1822. ^ Emigration to Liberia meant almost certain death and affliction for many immigrants because they encountered a new set of diseases. Mortality was particularly high during the early decades of colonization. From 1822 to 1843, about 48 percent of all immigrants died of various causes, usually within their first year. The bulk of the deaths is attributed to malaria. There was no natural increase in the population for this early period and because American “Negroes” were unenthusiastic about relocation to Liberia, immigration remained sparse throughout the century. Low immigration, combined with the high death rate, deprived the fledgling colony of its potential human resource, especially for the cultivation of labor-intensive crops, like sugar cane and coffee. Moreover, even though females constituted approximately half of the settlers, they seldom performed agricultural labor. ^ The problem of labor was compounded by the scarcity of draft animals. Liberia is in the region where trypanosomiasis occurs. The disease is fatal to large livestock. Therefore, animal-drawn plows, common in the United States, were never successfully transplanted in Liberia. Besides, the dearth of livestock obstructed the development of the sugar industry since many planters depended on oxen-powered mills because they could not afford to buy the more expensive steam engine mills. ^ Finally, nearly half of the immigrants were newly emancipated slaves. Usually these former bondsmen arrived in Liberia penniless. Consequently, they lacked the capital to invest in large-scale plantations. The other categories of immigrants (e.g., those who purchased their freedom), were hardly better off than the emancipated slaves. ^

Sistema de monitoramento de perdas visíveis de cana-de-açúcar em colhedora de cana picada

In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.

Projeto de um cortador de base para colhedora de cana-de-açúcar utilizando otimização matemática

A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .

Colheita de cana-de-açúcar com auxílio mecânico

Civil society and sugarcane farmer demands indicate that harvesting technology has enough limitations to jeopardize production in large sugar cane producing areas. This work analyses the current mechanical harvesting compared to a semi-mechanical harvesting proposal, on the bases of eleven characteristics considered determinant for a quick spreading of green cane harvesting on hilly areas, with lower impact on agricultural labor and farmers investment capacity.

Análise de aspectos socioeconômicos e tecnológicos da agropecuária na Bacia Hidrográfica do Rio Mogi Guaçu

Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.

Avaliação de perdas invisíveis na colheita mecanizada em dois fluxos de massa de cana-de-açúcar

In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.

Sistema de sincronismo entre a colhedora de cana-de-açúcar e o veículo de transbordo

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Suplementação com caldo de cana de açucar comparado com outros carboidratos na reposição do glicogenio e cinetica de biomarcadores pos-exercicio agudo em ratos

Universidade Estadual de Campinas . Faculdade de Educação Física

Metabolismo mineral em bubalinos com ingestões de diferentes níveis de fósforo

Objetivou-se avaliar os efeitos da ingestão diária de quatro níveis de fósforo (8, 12, 15 e 18 g) sobre o metabolismo de macrominerais (P, Ca, Mg, Na, K e S), incluindo a ingestão, a concentração no rúmen, a taxa de passagem do líquido ruminal, a excreção nas fezes e a disponibilidade aparente. Utilizaram-se quatro bubalinos adultos com fístulas ruminais em delineamento quadrado latino (4 × 4) com dieta total constituída de cana-de-açúcar como volumoso (85%) e concentrado formulado com um dos níveis de fósforo. Os níveis de fósforo não ocasionaram diferença significativa na concentração mineral no rúmen de nenhum mineral estudado. A concentração média de fósforo no conteúdo ruminal foi de 0,98% na matéria seca, enquanto o teor de fósforo nas rações variou de 0,12 a 0,34%, comprovando alta reciclagem de fósforo pela saliva. Níveis crescentes de fósforo na dieta, variando de 8 a 18 g/animal/dia, não influenciam as disponibilidades de cálcio e magnésio. Com o nível de fósforo de 15 g/dia, houve melhor utilização do fósforo da dieta. A ingestão de níveis crescentes de fósforo em g/kg0,75 (X) promoveu aumento linear na excreção fecal desse mineral em g/kg0,75 (Y) e baixos valores de disponibilidade do fósforo, que pode ser estimado pela equação Y = 0,03 + 0,610X, o que indica deficiência desse elemento mineral na dieta para o metabolismo animal.

Effects of dietary energy and nitrogen supplements on rumen fermentation and protozoa population in buffalo and zebu cattle

The effects were assessed of two energy sources in concentrate (ground grain corn vs. citrus pulp) and two nitrogen sources (soybean meal vs. urea) on rumen metabolism in four buffaloes and four zebu cattle (Nellore) with rumen cannula and fed in a 4 × 4 Latin square design with feeds containing 60% sugar cane. Energy supplements had no effect on the rumen ammonia concentration in cattle, but ground grain corn promoted higher ammonia level than citrus pulp in buffalo. Urea produced higher ammonia level than soybean meal in both animal species. On average, the buffaloes maintained a lower rumen ammonia concentration (11.7 mg/dL) than the cattle (14.5 mg/dL). Buffaloes had lower production of acetic acid than cattle (58.7 vs. 61.6 mol/100 mol) and higher of propionic acid (27.4 vs. 23.6 mol/100 mol). There was no difference in the butyric acid production between the buffaloes (13.6 mol/100 mol) and cattle (14.8 mol/100 mol) and neither in the total volatile fatty acids concentration (82.5 vs. 83.6 mM, respectively). The energy or nitrogen sources had no effect on rumen protozoa count in either animal species. The zebu cattle had higher rumen protozoa population (8.8 × 10(5)/mL) than the buffaloes (6.1 × 10(5)/mL). The rumen protozoa population differed between the animal species, except for Dasytricha and Charonina. The buffaloes had a lower Entodinium population than the cattle (61.0 vs 84.9%, respectively) and a greater percentage of species belonging to the Diplodiniinae subfamily than the cattle (28.6 vs. 1.4%, respectively). In cattle, ground corn is a better energy source than citrus pulp for use by Entodinium and Diplodiniinae. In the buffaloes, the Entodinium are favored by urea and Diplodiniinae species by soybean meal.