Nature-based solutions for urban heat island effect mitigation: the case study of Isla, Malta

Global population growth reflects how humans increasingly exploited Earth's resources. Urbanization develops along with anthropization. It is estimated that nearly 60% of the world's population lives in urban areas, which symbolize the denaturalized dimension of current modernity. Cities are artificial ecosystems that suffer most from environmental issues and climate change. The Urban Heat Island (UHI) effect is a common microclimatic phenomenon affecting cities, which causes considerable differences between urban and rural areas temperatures. Among the driving factors, the lack of vegetation in urban settlements can damage both humans and the environment (health diseases, heat waves caused deaths, biodiversity loss, and so on). As the world continues to urbanize, sustainable development increasingly depends on successful management of urban areas. To enhance cities’ resilience, Nature-based Solutions (NbSs), are defined as an umbrella concept that encompasses a wide range of ecosystem-based approaches and actions to climate change adaptation (CCA) and disaster risk reduction (DRR). This paper analyzes a 15-days study on air temperature trends carried out in Isla, a small locality in the Maltese archipelago, and proposes Nature-based Solutions-characterized scenarios to mitigate the Urban Heat Island effect the Mediterranean city is affected by. The results demonstrates how in some areas where vegetation is present, lower temperatures are recorded than in areas where vegetation is absent or scarce. It also appeared that in one location, the specific type of vegetation does not contribute to high temperature mitigation, whereas in another one, different environmental parameters can influence the measurements. Among the case-specific Nature-based Solutions proposed there are vertical greening (green wall, façades, ground based greening, etc.), tree lines, green canopy, and green roofs.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Heat treatment of a direct composite resin: influence on flexural strength

The purpose of this study was to evaluate the flexural strength of a direct composite, for indirect application, that received heat treatment, with or without investment. One indirect composite was used for comparison. For determination of the heat treatment temperature, thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) were performed, considering the initial weight loss temperature and glass transition temperature (Tg). Then, after photoactivation (600 mW/cm² - 40 s), the specimens (10 x 2 x 2 mm) were heat-treated following these conditions: 170ºC for 5, 10 or 15 min, embedded or not embedded in investment. Flexural strength was assessed as a means to evaluate the influence of different heat treatment periods and investment embedding on mechanical properties. The data were analyzed by ANOVA and Tukey's test (α = 0.05). TGA showed an initial weight loss temperature of 180ºC and DSC showed a Tg value of 157°C. Heat treatment was conducted in an oven (Flli Manfredi, Italy), after 37°C storage for 48 h. Flexural strength was evaluated after 120 h at 37°C storage. The results showed that different periods and investment embedding presented similar statistical values. Nevertheless, the direct composite resin with treatments presented higher values (178.7 MPa) compared to the indirect composite resin (146.0 MPa) and the same direct composite submitted to photoactivation only (151.7 MPa). Within the limitations of this study, it could be concluded that the heat treatment increased the flexural strength of the direct composite studied, leading to higher mechanical strength compared to the indirect composite.

Infectious endocarditis caused by Nocardia sp.: histological morphology as a guide for the specific diagnosis

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Hydrometeor and latent heat profiles of tropical cyclones Conson, Ivan and Catarina using PR/TRMM data

ABSTRACT Microphysical and thermodynamical features of two tropical systems, namely Hurricane Ivan and Typhoon Conson, and one sub-tropical, Catarina, have been analyzed based on space-born radar PR measurements available on the TRMM satellite. The procedure to classify the reflectivity profiles followed the Heymsfield et al (2000) and Steiner et al (1995) methodologies. The water and ice content have been calculated using a relationship obtained with data of the surface SPOL radar and PR in Rondonia State in Brazil. The diabatic heating rate due to latent heat release has been estimated using the methodology developed by Tao et al (1990). A more detailed analysis has been performed for Hurricane Catarina, the first of its kind in South Atlantic. High water content mean value has been found in Conson and Ivan at low levels and close to their centers. Results indicate that hurricane Catarina was shallower than the other two systems, with less water and the water was concentrated closer to its center. The mean ice content in Catarina was about 0.05 g kg-1 while in Conson it was 0.06 g kg-1 and in Ivan 0.08 g kg-1. Conson and Ivan had water content up to 0.3 g kg-1 above the 0ºC layer, while Catarina had less than 0.15 g kg-1. The latent heat released by Catarina showed to be very similar to the other two systems, except in the regions closer to the center.

Effect of experimental heat treatment on mechanical properties of resin composites

The aim of this study was to verify the influence of an experimental heat treatment (170ºC/10 min) using a casting furnace on the mechanical properties (hardness and flexural strength) of 2 commercial direct resin composites (TPH Spectrum and Filtek P60) compared to a commercial indirect resin system (BelleGlass). Heat treatment temperature was determined after thermal characterization by thermogravimetry (TG) and differential scanning calorimetry (DSC). Data was analyzed by ANOVA and Tukey's test at 5% significance level. There was statistical significance for the main factor heat treatment (p=0.03) and composite (p=0.02), for flexural strength. For Knoop hardness, only the main factor composite was statistically significant (p=0.00). P60 presented higher hardness than TPH. No statistically significant correlation between mechanical properties tested was detected. Based on these results, it was possible to conclude that heat treatment influenced flexural strength of direct composites, while it was not observed for hardness. The association of direct composites with a simple post-cure heat treatment may be an alternative for current indirect composite systems, although more studies are needed to verify other properties of the composites for this application.

Biotin-avidin sandwich elisa with specific human isotypes IgG1 and IgG4 for Culicidae mosquito blood meal identification from an epizootic yellow fever area in Brazil

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Soy isoflavones reduce heat shock proteins in postmenopausal women

Background: Atherosclerosis and its complications remain the most common cause of death in postmenopausal women. But there are few studies evaluating in hormonal theraphy can affect the autoimmune response involved in atherosclerosis. Objective to evaluate the effects to soy germ isoflavones and hormone replacement theraphy on antibodies against heat shock proteins (HPSP60, HPSP70 and HSC70) in moderately hypertensive hypercholesterolemic postmenopausal women. Methods: Women were treated with soy germ (2g/day) 17'beta'-estradiol(2 mg/day) or 17'beta'-estradiol (2mg/day)+noretisterone acetate (1mg/day), for 3 months after taking placebo for 1 month. The plasma autoantibodies to HSP60, HSP70 and HSC70 were determined by ELISA. Results: Data showed a reduction of autoantibodies against HSC70 after treatment in the 3 studies groups in relation to the placebo. The antibodies reactive to HSP70 were reduced only in women receiving soy germ. No significant differences were found for antibodies against HSP60. Conclusion: The soy germ isoflavones and 17'beta'-estradiol, alone or associated with noretisterone acetate, had similar effects on reduction of antibodies reactive to HSP70 in moderately hypertensive hypercholesterolemic postmenopausal women after 3 months of treatment. Thus, there results indicate that soy isoflavnes and hormone theraphy may modulate some pathways of the immune-inflammatory process in postmenopausal women at high risk for atherosclerosis.

Evaluation of Ti(3)Si Phase Stability from Heat-Treated, Rapidly Solidified Ti-Si Alloys

Ti-base alloys containing significant amounts of silicon have been considered for high temperature structural applications. Thus, information concerning phase stability on the Ti-Si system is fundamental and there are not many investigations covering the phase stability of the Ti(3)Si phase, specially its dependence on oxygen/nitrogen contamination. In this work the stability of this phase has been evaluated through heat-treatment of rapidly solidified Ti-rich Ti-Si alloys at 700 A degrees C and 1000 A degrees C. The rapidly solidified splats presented nanometric scale microstructures which facilitated the attainment of equilibrium conditions. The destabilization of Ti(3)Si due to oxygen/nitrogen contamination has been noted.