Microbial Lipid Production: Screening With Yeasts Grown On Brazilian Molasses.

Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.

Propylthiouracil Quantification In Human Plasma By High-performance Liquid Chromatography Coupled With Electrospray Tandem Mass Spectrometry: Application In A Bioequivalence Study.

A rapid, sensitive and specific method for quantifying propylthiouracil in human plasma using methylthiouracil as the internal standard (IS) is described. The analyte and the IS were extracted from plasma by liquid-liquid extraction using an organic solvent (ethyl acetate). The extracts were analyzed by high performance liquid chromatography coupled with electrospray tandem mass spectrometry (HPLC-MS/MS) in negative mode (ES-). Chromatography was performed using a Phenomenex Gemini C18 5μm analytical column (4.6mm×150mm i.d.) and a mobile phase consisting of methanol/water/acetonitrile (40/40/20, v/v/v)+0.1% of formic acid. For propylthiouracil and I.S., the optimized parameters of the declustering potential, collision energy and collision exit potential were -60 (V), -26 (eV) and -5 (V), respectively. The method had a chromatographic run time of 2.5min and a linear calibration curve over the range 20-5000ng/mL. The limit of quantification was 20ng/mL. The stability tests indicated no significant degradation. This HPLC-MS/MS procedure was used to assess the bioequivalence of two propylthiouracil 100mg tablet formulations in healthy volunteers of both sexes in fasted and fed state. The geometric mean and 90% confidence interval CI of Test/Reference percent ratios were, without and with food, respectively: 109.28% (103.63-115.25%) and 115.60% (109.03-122.58%) for Cmax, 103.31% (100.74-105.96%) and 103.40% (101.03-105.84) for AUClast. This method offers advantages over those previously reported, in terms of both a simple liquid-liquid extraction without clean-up procedures, as well as a faster run time (2.5min). The LOQ of 20ng/mL is well suited for pharmacokinetic studies. The assay performance results indicate that the method is precise and accurate enough for the routine determination of the propylthiouracil in human plasma. The test formulation with and without food was bioequivalent to reference formulation. Food administration increased the Tmax and decreased the bioavailability (Cmax and AUC).

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Evaluation Of The Location Of Capsules Swallowed With Food During The Pharyngeal Phase Triggering In Asymptomatic Adults.

To assess the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. The location of the bolus during the pharyngeal phase triggering provides information about the sensorimotor model of the beginning of deglutition onset. To evaluate the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. A videofluoroscopy swallowing study was carried out in 60 subjects (14 male and 46 female participants) aged between 27 and 55 years, who were evaluated with hard gelatin capsules #00 and #3 containing barium sulfate, swallowed with liquid food and pudding, in free volume. The first laryngeal elevation movement was the criterion to locate the pharyngeal phase triggering. Statistical analysis was based on the McNemar test. Capsule #3 presented higher percentage of location in the tongue dorsum compared to capsule #00, and capsule #00 presented higher percentage of location in the tongue base and vallecula compared to capsule #3. There was a difference between different capsules swallowed with liquid (p=0.016) and pudding (p=0.037). The capsule size influenced the location of the pharyngeal phase triggering. Smaller capsules started pharyngeal phase in the most anterior region (tongue dorsum) compared to larger capsules.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Mechanisms Of Insulin Resistance In The Amygdala: Influences On Food Intake.

Obesity is increasing worldwide and is triggered, at least in part, by enhanced caloric intake. Food intake is regulated by a complex mechanism involving the hypothalamus and hindbrain circuitries. However, evidences have showing that reward systems are also important in regulating feeding behavior. In this context, amygdala is considered a key extra-hypothalamic area regulating feeding behavior in human beings and rodents. This review focuses on the regulation of food intake by amygdala and the mechanisms of insulin resistance in this brain area. Similar to the hypothalamus the anorexigenic effect of insulin is mediated via PI3K (phosphoinositide 3-kinase)/Akt (protein kinase B) pathway in the amygdala. Insulin decreases NPY (neuropeptide Y) and increases oxytocin mRNA levels in the amygdala. High fat diet and saturated fatty acids induce inflammation, ER (endoplasmic reticulum) stress and the activation of serine kinases such as PKCθ (protein kinase C theta), JNK (c-Jun N-terminal kinase) and IKKβ (inhibitor of nuclear factor kappa-B kinase beta) in the amygdala, which have an important role in insulin resistance in this brain region. Overexpressed PKCθ in the CeA (central nucleus of amygdala) of rats increases weight gain, food intake, insulin resistance and hepatic triglycerides content. The inhibition of ER stress ameliorates insulin action/signaling, increases oxytocin and decreases NPY gene expression in the amygdala of high fat feeding rodents. Those data suggest that PKCθ and ER stress are main mechanisms of insulin resistance in the amygdala of obese rats and play an important role regulating feeding behavior.

Sorghum Flour Fractions: Correlations Among Polysaccharides, Phenolic Compounds, Antioxidant Activity And Glycemic Index.

Nutrients composition, phenolic compounds, antioxidant activity and estimated glycemic index (EGI) were evaluated in sorghum bran (SB) and decorticated sorghum flour (DSF), obtained by a rice-polisher, as well as whole sorghum flour (WSF). Correlation between EGI and the studied parameters were determined. SB presented the highest protein, lipid, ash, β-glucan, total and insoluble dietary fiber contents; and the lowest non-resistant and total starch contents. The highest carbohydrate and resistant starch contents were in DSF and WSF, respectively. Phenolic compounds and antioxidant activities were concentrated in SB. The EGI values were: DSF 84.5±0.41; WSF 77.2±0.33; and SB 60.3±0.78. Phenolic compounds, specific flavonoids and antioxidant activities, as well as total, insoluble and soluble dietary fiber and β-glucans of sorghum flour samples were all negatively correlated to EGI. RS content was not correlated to EGI.

Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) food habits in a mosaic of Atlantic Rainforest and eucalypt plantations of southeastern Brazil

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

A reclusão pubertaria no Kamayura de Ipawu : um enfoque biocultural

Universidade Estadual de Campinas. Faculdade de Educação Física

Qualidade de vida e diabetes

Universidade Estadual de Campinas. Faculdade de Educação Física

Infectious endocarditis caused by Nocardia sp.: histological morphology as a guide for the specific diagnosis

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Medidas murinométricas e eficiência alimentar em ratos provenientes de ninhadas reduzidas na lactação e submetidos ou não ao exercício de natação

INTRODUÇÃO: Excesso de alimentação no início da vida pode modificar persistentemente consumo e peso corporal. Adoção de exercício físico é uma estratégia útil para evitar excessivo ganho de peso. OBJETIVO: Avaliar o crescimento corporal e a eficiência alimentar em ratos provenientes de ninhada reduzida no aleitamento. MÉTODOS: Ao terceiro dia de vida, ninhadas foram formadas com quatro (GN4) ou 10 animais (GN10), (n = 25). Ao desmame, ratos machos Wistar permaneceram em gaiolas individuais, e, aos 60 (± 2) dias foram subdivididos em sedentários (SED) e exercitados (NAT), formando quatro grupos: GN4SED, GN10SED, GN4-NAT e GN10NAT. Avaliou-se o peso, ganho de peso e taxa específica de ganho de peso, gordura epididimal, índices de massa corporal e Lee, consumo e eficiência alimentar, glicemia e lactemia. RESULTADOS: Aos 21 dias, o GN4 apresentava peso corporal 52% acima do GN10 (P = 0,001). Contudo, aos 30 e 60 dias os pesos não diferiram. Ao final do período, GN10NAT demonstrou menor peso (356,82 ± 23,04) que GN10SED (409,28 ± 17,30). Mas GN4NAT possuía maior peso (417,85 ± 37,91) que GN4SED (413,69 ± 57,45) e GN10NAT. O GN4 exibiu elevada taxa de ganho de peso na lactação, mas, redução da mesma pós-desmame. Independente do tamanho da ninhada, a taxa de ganho de peso reduz com o aumento da idade. Ao final do período, glicemia, gordura epididimal total e relativa, e os índices de Lee e IMC não diferiram entre os grupos. Os valores de lactato antes e após o exercício condizem com esforço de intensidade moderada. Na periadolescência, GN4 apresentou menor ingestão de alimentos, mas sem diferenças na vida adulta. CONCLUSÃO: A redução da ninhada no aleitamento não alterou o peso corporal ou ingestão alimentar persistentemente. Entretanto, o protocolo de natação foi eficaz em reduzir o ganho de peso em animais controles, mas não naqueles de ninhada reduzida.