1000 resultados para Emenda parlamentar, periódico, Brasil
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.
Resumo:
A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.
Resumo:
INTRODUCTION: Subclinical hypothyroidism (SCH), defined as elevated concentrations of thyroid stimulating hormone (TSH) despite normal levels of thyroid hormones, is highly prevalent in Brazil, especially among women and the elderly. Although an increasing number of studies have related SCH to an increased risk of coronary artery disease and mortality, there have been no randomized clinical trials verifying the benefit of levothyroxine treatment in reducing these risks, and the treatment remains controversial. OBJECTIVE: This consensus, sponsored by the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism and developed by Brazilian experts with extensive clinical experience with thyroid diseases, presents these recommendations based on evidence for the clinical management of SCH patients in Brazil. MATERIALS AND METHODS: After structuring the clinical questions, the search for evidence in the literature was initially performed in the MedLine-PubMed database and later in the Embase and SciELO - Lilacs databases. The strength of evidence was evaluated according to the Oxford classification system and established based on the experimental design used, considering the best available evidence for each question and the Brazilian experience. RESULTS: The topics covered included SCH definition and diagnosis, natural history, clinical significance, treatment and pregnancy, and the consensus issued 29 recommendations for the clinical management of adult patients with SCH. CONCLUSION: Treatment with levothyroxine was recommended for all patients with persistent SCH with serum TSH values > 10 mU/L and for certain patient subgroups.
Resumo:
Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.
Resumo:
Paracoccidioidomycosis is the most frequent systemic mycosis in Brazil, but ocular involvement is rare and, if present, often secondary to another site. The authors report a case of paracoccidioidomycosis of eyelid and conjunctiva where no extraocular focus was found. A brief review of the literature is made discussing the importance of diagnostic suspecion in a population at risk and early treatment for a good visual prognosis.
Resumo:
Purpose: To establish the prevalence of refractive errors and ocular disorders in preschool and schoolchildren of Ibiporã, Brazil. Methods: A survey of 6 to 12-year-old children from public and private elementary schools was carried out in Ibiporã between 1989 and 1996. Visual acuity measurements were performed by trained teachers using Snellen's chart. Children with visual acuity <0.7 in at least one eye were referred to a complete ophthalmologic examination. Results: 35,936 visual acuity measurements were performed in 13,471 children. 1.966 children (14.59%) were referred to an ophthalmologic examination. Amblyopia was diagnosed in 237 children (1.76%), whereas strabismus was observed in 114 cases (0.84%). Cataract (n=17) (0.12%), chorioretinitis (n=38) (0.28%) and eyelid ptosis (n=6) (0.04%) were also diagnosed. Among the 614 (4.55%) children who were found to have refractive errors, 284 (46.25%) had hyperopia (hyperopia or hyperopic astigmatism), 206 (33.55%) had myopia (myopia or myopic astigmatism) and 124 (20.19%) showed mixed astigmatism. Conclusions: The study determined the local prevalence of amblyopia, refractive errors and eye disorders among preschool and schoolchildren.
Resumo:
This paper describes a topiramate induced acute bilateral angle-closure glaucoma. This rare adverse effect is an idiosyncratic reaction characterized by uveal effusion and lens forward displacement, leading to increased intraocular pressure and vision loss. We describe a 55 year-old white woman with migraine, spasmodic torticollis and essential tremor, who developed bilateral acute angle-closure glaucoma, one week after starting topiramate 25 mg/day. She was seen at the Ophthalmology Emergency Department of the Fundação João Penido Burnier (Campinas, SP, Brazil) with a 4 hours history of blurry vision, ocular pain and bright flashes vision. Slit lamp examination revealed moderate conjunctival injection and corneal edema, and shallow anterior chambers. Intraocular pressure was 48 mmHg in both eyes. Fundoscopic examination findings were normal. She was treated with timolol, brimonidine, dorzolamide, pilocarpine, prednisone acetate eye drops and acetazolamide. One hour after those measures, as the intraocular pressure was 30 mmHg, she received a manitol intravenous injection and the intraocular pressure normalized. After 24 hours an iridotomy with Yag laser was performed. Topiramate was discontinued and she was totally recovered after one week.
Resumo:
Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física