954 resultados para Discrete Events Simulation
Resumo:
This research investigated the simulation model behaviour of a traditional and combined discrete event as well as agent based simulation models when modelling human reactive and proactive behaviour in human centric complex systems. A departmental store was chosen as human centric complex case study where the operation system of a fitting room in WomensWear department was investigated. We have looked at ways to determine the efficiency of new management policies for the fitting room operation through simulating the reactive and proactive behaviour of staff towards customers. Once development of the simulation models and their verification had been done, we carried out a validation experiment in the form of a sensitivity analysis. Subsequently, we executed a statistical analysis where the mixed reactive and proactive behaviour experimental results were compared with some reactive experimental results from previously published works. Generally, this case study discovered that simple proactive individual behaviour could be modelled in both simulation models. In addition, we found the traditional discrete event model performed similar in the simulation model output compared to the combined discrete event and agent based simulation when modelling similar human behaviour.
MINING AND VERIFICATION OF TEMPORAL EVENTS WITH APPLICATIONS IN COMPUTER MICRO-ARCHITECTURE RESEARCH
Resumo:
Computer simulation programs are essential tools for scientists and engineers to understand a particular system of interest. As expected, the complexity of the software increases with the depth of the model used. In addition to the exigent demands of software engineering, verification of simulation programs is especially challenging because the models represented are complex and ridden with unknowns that will be discovered by developers in an iterative process. To manage such complexity, advanced verification techniques for continually matching the intended model to the implemented model are necessary. Therefore, the main goal of this research work is to design a useful verification and validation framework that is able to identify model representation errors and is applicable to generic simulators. The framework that was developed and implemented consists of two parts. The first part is First-Order Logic Constraint Specification Language (FOLCSL) that enables users to specify the invariants of a model under consideration. From the first-order logic specification, the FOLCSL translator automatically synthesizes a verification program that reads the event trace generated by a simulator and signals whether all invariants are respected. The second part consists of mining the temporal flow of events using a newly developed representation called State Flow Temporal Analysis Graph (SFTAG). While the first part seeks an assurance of implementation correctness by checking that the model invariants hold, the second part derives an extended model of the implementation and hence enables a deeper understanding of what was implemented. The main application studied in this work is the validation of the timing behavior of micro-architecture simulators. The study includes SFTAGs generated for a wide set of benchmark programs and their analysis using several artificial intelligence algorithms. This work improves the computer architecture research and verification processes as shown by the case studies and experiments that have been conducted.
Resumo:
The first goal of this study is to analyse a real-world multiproduct onshore pipeline system in order to verify its hydraulic configuration and operational feasibility by constructing a simulation model step by step from its elementary building blocks that permits to copy the operation of the real system as precisely as possible. The second goal is to develop this simulation model into a user-friendly tool that one could use to find an “optimal” or “best” product batch schedule for a one year time period. Such a batch schedule could change dynamically as perturbations occur during operation that influence the behaviour of the entire system. The result of the simulation, the ‘best’ batch schedule is the one that minimizes the operational costs in the system. The costs involved in the simulation are inventory costs, interface costs, pumping costs, and penalty costs assigned to any unforeseen situations. The key factor to determine the performance of the simulation model is the way time is represented. In our model an event based discrete time representation is selected as most appropriate for our purposes. This means that the time horizon is divided into intervals of unequal lengths based on events that change the state of the system. These events are the arrival/departure of the tanker ships, the openings and closures of loading/unloading valves of storage tanks at both terminals, and the arrivals/departures of trains/trucks at the Delivery Terminal. In the feasibility study we analyse the system’s operational performance with different Head Terminal storage capacity configurations. For these alternative configurations we evaluated the effect of different tanker ship delay magnitudes on the number of critical events and product interfaces generated, on the duration of pipeline stoppages, the satisfaction of the product demand and on the operative costs. Based on the results and the bottlenecks identified, we propose modifications in the original setup.
Resumo:
This thesis seeks to analyse the performance of dynamic slice provisioning in a 5G metro network with the low latency and reliability guaranties. This elaborate highlight the comparison in terms of performance of two versions of a simulator developed in Python based on different models: the Exhaustive research model and Shortest Path First Fit (SPFF) model. It further presents the differences between the dedicated path protection and the shared path protection. This analysis is made through several simulations at different network conditions by varying networks resources and observing the network performances while comparing the 2 models mentioned above. A reconfiguration procedure was implemented on backup resources in the shortest path first fit in order to improve its performance with respect to the exhaustive research which is more optimised. Subsequently, several triggering events was implemented, for the reconfiguration. And a comparison is made between these different triggering events in terms blocking probability, bandwidth at link, capacity at each node, primary and backup bandwidth per slice and backup capacity per slice.
Resumo:
Maxillofacial trauma resulting from falls in elderly patients is a major social and health care concern. Most of these traumatic events involve mandibular fractures. The aim of this study was to analyze stress distributions from traumatic loads applied on the symphyseal, parasymphyseal, and mandibular body regions in the elderly edentulous mandible using finite-element analysis (FEA). Computerized tomographic analysis of an edentulous macerated human mandible of a patient approximately 65 years old was performed. The bone structure was converted into a 3-dimensional stereolithographic model, which was used to construct the computer-aided design (CAD) geometry for FEA. The mechanical properties of cortical and cancellous bone were characterized as isotropic and elastic structures, respectively, in the CAD model. The condyles were constrained to prevent free movement in the x-, y-, and z-axes during simulation. This enabled the simulation to include the presence of masticatory muscles during trauma. Three different simulations were performed. Loads of 700 N were applied perpendicular to the surface of the cortical bone in the symphyseal, parasymphyseal, and mandibular body regions. The simulation results were evaluated according to equivalent von Mises stress distributions. Traumatic load at the symphyseal region generated low stress levels in the mental region and high stress levels in the mandibular neck. Traumatic load at the parasymphyseal region concentrated the resulting stress close to the mental foramen. Traumatic load in the mandibular body generated extensive stress in the mandibular body, angle, and ramus. FEA enabled precise mapping of the stress distribution in a human elderly edentulous mandible (neck and mandibular angle) in response to 3 different traumatic load conditions. This knowledge can help guide emergency responders as they evaluate patients after a traumatic event.
Resumo:
In this work, the energy response functions of a CdTe detector were obtained by Monte Carlo (MC) simulation in the energy range from 5 to 160keV, using the PENELOPE code. In the response calculations the carrier transport features and the detector resolution were included. The computed energy response function was validated through comparison with experimental results obtained with (241)Am and (152)Eu sources. In order to investigate the influence of the correction by the detector response at diagnostic energy range, x-ray spectra were measured using a CdTe detector (model XR-100T, Amptek), and then corrected by the energy response of the detector using the stripping procedure. Results showed that the CdTe exhibits good energy response at low energies (below 40keV), showing only small distortions on the measured spectra. For energies below about 80keV, the contribution of the escape of Cd- and Te-K x-rays produce significant distortions on the measured x-ray spectra. For higher energies, the most important correction is the detector efficiency and the carrier trapping effects. The results showed that, after correction by the energy response, the measured spectra are in good agreement with those provided by a theoretical model of the literature. Finally, our results showed that the detailed knowledge of the response function and a proper correction procedure are fundamental for achieving more accurate spectra from which quality parameters (i.e., half-value layer and homogeneity coefficient) can be determined.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
The purpose of this study was to evaluate the influence of intrapulpal pressure simulation on the bonding effectiveness of etch & rinse and self-etch adhesives to dentin. Eighty sound human molars were distributed into eight groups, according to the permeability level of each sample, measured by an apparatus to assess hydraulic conductance (Lp). Thus, a similar mean permeability was achieved in each group. Three etch & rinse adhesives (Prime & Bond NT - PB, Single Bond -SB, and Excite - EX) and one self-etch system (Clearfil SE Bond - SE) were employed, varying the presence or absence of an intrapulpal pressure (IPP) simulation of 15 cmH2O. After adhesive and restorative procedures were carried out, the samples were stored in distilled water for 24 hours at 37°C, and taken for tensile bond strength (TBS) testing. Fracture analysis was performed using a light microscope at 40 X magnification. The data, obtained in MPa, were then submitted to the Kruskal-Wallis test ( a = 0.05). The results revealed that the TBS of SB and EX was significantly reduced under IPP simulation, differing from the TBS of PB and SE. Moreover, SE obtained the highest bond strength values in the presence of IPP. It could be concluded that IPP simulation can influence the bond strength of certain adhesive systems to dentin and should be considered when in vitro studies are conducted.
Resumo:
Below cloud scavenging processes have been investigated considering a numerical simulation, local atmospheric conditions and particulate matter (PM) concentrations, at different sites in Germany. The below cloud scavenging model has been coupled with bulk particulate matter counter TSI (Trust Portacounter dataset, consisting of the variability prediction of the particulate air concentrations during chosen rain events. The TSI samples and meteorological parameters were obtained during three winter Campaigns: at Deuselbach, March 1994, consisting in three different events; Sylt, April 1994 and; Freiburg, March 1995. The results show a good agreement between modeled and observed air concentrations, emphasizing the quality of the conceptual model used in the below cloud scavenging numerical modeling. The results between modeled and observed data have also presented high square Pearson coefficient correlations over 0.7 and significant, except the Freiburg Campaign event. The differences between numerical simulations and observed dataset are explained by the wind direction changes and, perhaps, the absence of advection mass terms inside the modeling. These results validate previous works based on the same conceptual model.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Abstract This paper aims at assessing the performance of a program of thermal simulation (Arquitrop) in different households in the city of Sao Paulo, Brazil. The households were selected for the Wheezing Project which followed up children under 2 years old to monitor the occurrence of respiratory diseases. The results show that in all three study households there is a good approximation between the observed and the simulated indoor temperatures. It was also observed a fairly consistent and realistic behavior between the simulated indoor and the outdoor temperatures, describing the Arquitrop model as an efficient estimator and good representative of the thermal behavior of households in the city of Sao Paulo. The worst simulation is linked to the poorest type of construction. This may be explained by the bad quality of the construction, which the Architrop could not simulate adequately
Resumo:
We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use