Própolis do sudeste e nordeste do Brasil: influência da sazonalidade na atividade antibacteriana e composição fenólica

The composition and biological activities of propolis, a resinous hive product collected by honeybees from various plant sources, depends on various factors such as season and vegetation of the area. The aim of this study was to evaluate the influence of the seasonal effect on the ethanolic extracts of Brazilian propolis (EEP) type 6 and type 12, collected during 6 months in terms of antibacterial activity and phenolic composition. The antimicrobial properties were evaluated by MIC and MBC on S. mutans Ingbritt 1600 and the profile of chemical composition by UV-visible spectrophotometry, HPLC-RF and GC-MS. The results demonstrated that the season in which propolis is collected influences its chemical composition, resulting in modifications in its antibacterial activity.

Supercritical CO2 recovery of caffeine from green coffee oil: new experimental solubility data and modeling

The caffeine solubility in supercritical CO2 was studied by assessing the effects of pressure and temperature on the extraction of green coffee oil (GCO). The Peng-Robinson¹ equation of state was used to correlate the solubility of caffeine with a thermodynamic model and two mixing rules were evaluated: the classical mixing rule of van der Waals with two adjustable parameters (PR-VDW) and a density dependent one, proposed by Mohamed and Holder² with two (PR-MH, two parameters adjusted to the attractive term) and three (PR-MH3 two parameters adjusted to the attractive and one to the repulsive term) adjustable parameters. The best results were obtained with the mixing rule of Mohamed and Holder² with three parameters.

Flow injection green method for the quantitative analysis of ketoconazole in pharmaceutical preparations

A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.

Quantificação de antimônio em garrafas de politereftalato de etileno (PET) brasileiras por fluorescência de raios-X e avaliação quimiométrica para verificar a presença de pet reciclado através do teor de ferro

Antimony is a common catalyst in the synthesis of polyethylene terephthalate used for food-grade bottles manufacturing. However, antimony residues in final products are transferred to juices, soft drinks or water. The literature reports mentions of toxicity associated to antimony. In this work, a green, fast and direct method to quantify antimony, sulfur, iron and copper, in PET bottles by X-ray fluorescence spectrometry is presented. 2.4 to 11 mg Sb kg-1 were found in 20 samples analyzed. The coupling of the multielemental technique to chemometric treatment provided also the possibility to classify PET samples between bottle-grade PET/recycled PET blends by Fe content.

Resistência à compressão e remoção de folhas da cana-de-açúcar visando à colheita mecânica

Sugarcane holds an important place in the Brazilian economy. Grate part of the sugarcane harvested still accomplished largely manually. Sugarcane harvesters available in Brazil use the technology to chop the cane into 200 to 300 mm billets to allow on the go cane transferring to transport, contradicting the traditional method of whole stalk sugarcane harvesting system. In order to make whole stalk mechanical harvesting system possible, one of the barriers to be expired is the mechanical removal of the straw. The design of a mechanism that accomplishes this operation depends directly on the knowledge of the mechanical properties of the sugarcane related to its resistance to compression and the forces necessary to remove the leaves from the stalk. Compression tests were conducted using the universal testing machine. For leaves removal test by friction, a special apparatus was designed to allow the registration of the normal and traction force. The sugarcane stalk can resist up to 4.9 MPa. With a normal pressure of 0.8 MPa, which correspond to a friction force of 315 N, it is possible to remove the leaves, independent of its location in the sugarcane stalk.

Brazilian multicentre study of common mental disorders in primary care: rates and related social and demographic factors

Mental health problems are common in primary health care, particularly anxiety and depression. This study aims to estimate the prevalence of common mental disorders and their associations with socio-demographic characteristics in primary care in Brazil (Family Health Strategy). It involved a multicenter cross-sectional study with patients from Rio de Janeiro, São Paulo, Fortaleza (Ceará State) and Porto Alegre (Rio Grande do Sul State), assessed using the General Health Questionnaire (GHQ-12) and the Hospital Anxiety and Depression Scale (HAD). The rate of mental disorders in patients from Rio de Janeiro, São Paulo, Fortaleza and Porto Alegre were found to be, respectively, 51.9%, 53.3%, 64.3% and 57.7% with significant differences between Porto Alegre and Fortaleza compared to Rio de Janeiro after adjusting for confounders. Prevalence proportions of mental problems were especially common for females, the unemployed, those with less education and those with lower incomes. In the context of the Brazilian government's moves towards developing primary health care and reorganizing mental health policies it is relevant to consider common mental disorders as a priority alongside other chronic health conditions.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Syllable-timing in Brazilian Portuguese: uma crítica a Roy Major

This paper reintroduces the discussion about stress-timing in Brazilian Portuguese (BP). It begins by surveying some phonetic and phonological issues raised by the syllable- vs stress-timed dichotomy which culminated with the emergence of the p-center notion. Strict considerations of timing of V-V units and stress groups are taken into account to analyze the long term coupling of two basic oscillators (vowel and stress flow). This coupling allows a two-parameter characterization of language rhythms (coupling strength and speech rate) revealing that BP utterances present a high-degree of syllable-timing. A comparison with other languages, including European Portuguese, is also presented. The results analyzed indicate that Major's arguments for considering Portuguese (sic) as stress-timing are misleading.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Thyroid nodules and differentiated thyroid cancer: update on the Brazilian consensus

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Ocular findings in Brazilian identical twins with Cohen syndrome: case report

A case of identical male twins with Cohen syndrome who present multiple ophthalmic findings is reported. The patients were identical 16 year-old twin boys who showed down slanting eyelids, mild ptosis, high-grade myopia, small cortical lens opacities, posterior subcapsular cataracts, myotic and corectopic pupils with poor dilation due to focal iris atrophy and retinochoroidal dystrophy. Ophthalmologists must be aware of the ocular and systemic findings of Cohen syndrome in the evaluation of young patients with mental retardation and visual impairment.

Clinical trials in Brazilian journals of ophthalmology: where we are

PURPOSE: To compare clinical trials published in Brazilian journals of ophthalmology and in foreign journals of ophthalmology with respect to the number of citations and the quality of reporting [by applying the Consolidated Standards for Reporting Trials (CONSORT) statement writing standards]. METHODS: The sample of this systematic review comprised the two Brazilian journals of ophthalmology indexed at Science Citation Index Expanded and six of the foreign journals of ophthalmology with highest Impact Factor® according ISI. All clinical trials (CTs) published from January 2009 to December 2010 at the Brazilians journals and a 1:1 randomized sample of the foreign journals were included. The primary outcome was the number of citations through the end of 2011. Subgroup analysis included language. The secondary outcome included likelihood of citation (cited at least once versus no citation), and presence or absence of CONSORT statement indicators. RESULTS: The citation counts were statistically significantly higher (P<0.001) in the Foreign Group (10.50) compared with the Brazilian Group (0.45). The likelihood citation was statistically significantly higher (P<0.001) in the Foreign Group (20/20 - 100%) compared with the Brazilian Group (8/20 - 40%). The subgroup analysis of the language influence in Brazilian articles showed that the citation counts were statistically significantly higher in the papers published in English (P<0.04). Of 37 possible CONSORT items, the mean for the Foreign Group was 20.55 and for the Brazilian Group was 13.65 (P<0.003). CONCLUSION: The number of citations and the quality of reporting of clinical trials in Brazilian journals of ophthalmology still are low when compared with the foreign journals of ophthalmology with highest Impact Factor®.

Influence of English language in the number of citations of articles published in Brazilian journals of Ophthalmology

PURPOSE: To determine the association between language and number of citations of ophthalmology articles published in Brazilian journals. METHODS: This study was a systematic review. Original articles were identified by review of documents published at the two Brazilian ophthalmology journals indexed at Science Citation Index Expanded - SCIE [Arquivos Brasileiros de Oftalmologia (ABO) and Revista Brasileira de Oftalmologia (RBO)]. All document types (articles and reviews) listed at SCIE in English (English Group) or in Portuguese (Portuguese Group) from January 1, 2008 to December 31, 2009 were included, except: editorial materials; corrections; letters; and biographical items. The primary outcome was the number of citations through the end of second year after publication date. Subgroup analysis included likelihood of citation (cited at least once versus no citation), journal, and year of publication. RESULTS: The search at the web of science revealed 382 articles [107 (28%) in the English Group and 275 (72%) in the Portuguese Group]. Of those, 297 (77.7%) were published at the ABO and 85 (23.3%) at the RBO. The citation counts were statistically significantly higher (P<0.001) in the English Group (1.51 - SD 1.98 - range 0 to 11) compared with the Portuguese Group (0.57 - SD 1.06 - range 0 to 7). The likelihood citation was statistically significant higher (P<0.001) in the English Group (70/107 - 65.4%) compared with the Portuguese Group (89/275 - 32.7%). There were more articles published in English at the ABO (98/297 - 32.9%) than at the RBO (9/85 - 10.6%) [P<0.001]. There were no significant difference (P=0.967) at the proportion of articles published in English at the years 2008 (48/172 - 27.9%) and 2009 (59/210 - 28.1%). CONCLUSION: The number of citations of articles published in Portuguese at Brazilian ophthalmology journals is lower than the published in English. The results of this study suggest that the editorial boards should strongly encourage the authors to adopt English as the main language in their future articles.

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física