992 resultados para Antigen detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Abstract. Dendritic cells are antigen presenting cells that provide a vital link between the innate and adaptive immune system. Research into this family of cells has revealed that they perform the role of coordinating T-cell based immune responses, both reactive and for generating tolerance. We have derived an algorithm based on the functionality of these cells, and have used the signals and differentiation pathways to build a control mechanism for an artificial immune system. We present our algorithmic details in addition to some preliminary results, where the algorithm was applied for the purpose of anomaly detection. We hope that this algorithm will eventually become the key component within a large, distributed immune system, based on sound immunological concepts.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Dendritic cells are antigen presenting cells that provide a vital link between the innate and adaptive immune system, providing the initial detection of pathogenic invaders. Research into this family of cells has revealed that they perform information fusion which directs immune responses. We have derived a Dendritic Cell Algorithm based on the functionality of these cells, by modelling the biological signals and differentiation pathways to build a control mechanism for an artificial immune system. We present algorithmic details in addition to experimental results, when the algorithm was applied to anomaly detection for the detection of port scans. The results show the Dendritic Cell Algorithm is successful at detecting port scans.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Dendritic cells are antigen presenting cells that provide a vital link between the innate and adaptive immune system. Research into this family of cells has revealed that they perform the role of coordinating T-cell based immune responses, both reactive and for generating tolerance. We have derived an algorithm based on the functionality of these cells, and have used the signals and differentiation pathways to build a control mechanism for an artificial immune system. We present our algorithmic details in addition to some preliminary results, where the algorithm was applied for the purpose of anomaly detection. We hope that this algorithm will eventually become the key component within a large, distributed immune system, based on sound imnological concepts.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Artificial immune systems have previously been applied to the problem of intrusion detection. The aim of this research is to develop an intrusion detection system based on the function of Dendritic Cells (DCs). DCs are antigen presenting cells and key to the activation of the human immune system, behaviour which has been abstracted to form the Dendritic Cell Algorithm (DCA). In algorithmic terms, individual DCs perform multi-sensor data fusion, asynchronously correlating the fused data signals with a secondary data stream. Aggregate output of a population of cells is analysed and forms the basis of an anomaly detection system. In this paper the DCA is applied to the detection of outgoing port scans using TCP SYN packets. Results show that detection can be achieved with the DCA, yet some false positives can be encountered when simultaneously scanning and using other network services. Suggestions are made for using adaptive signals to alleviate this uncovered problem.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Artificial immune systems, more specifically the negative selection algorithm, have previously been applied to intrusion detection. The aim of this research is to develop an intrusion detection system based on a novel concept in immunology, the Danger Theory. Dendritic Cells (DCs) are antigen presenting cells and key to the activation of the human immune system. DCs perform the vital role of combining signals from the host tissue and correlate these signals with proteins known as antigens. In algorithmic terms, individual DCs perform multi-sensor data fusion based on time-windows. The whole population of DCs asynchronously correlates the fused signals with a secondary data stream. The behaviour of human DCs is abstracted to form the DC Algorithm (DCA), which is implemented using an immune inspired framework, libtissue. This system is used to detect context switching for a basic machine learning dataset and to detect outgoing portscans in real-time. Experimental results show a significant difference between an outgoing portscan and normal traffic.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Abstract. Dendritic cells are antigen presenting cells that provide a vital link between the innate and adaptive immune system. Research into this family of cells has revealed that they perform the role of coordinating T-cell based immune responses, both reactive and for generating tolerance. We have derived an algorithm based on the functionality of these cells, and have used the signals and differentiation pathways to build a control mechanism for an artificial immune system. We present our algorithmic details in addition to some preliminary results, where the algorithm was applied for the purpose of anomaly detection. We hope that this algorithm will eventually become the key component within a large, distributed immune system, based on sound immunological concepts.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Breast cancer is one of the most prevalent forms of cancer in women. Despite all recent advances in early diagnosis and therapy, mortality data is not decreasing. This is an outcome of the inexistence of validated serum biomarkers allowing an early prognosis, out coming from the limited understanding of the natural history of the disease. In this context, miRNAs have been attracting a special interest throughout the scientific community as promising biomarkers in the early diagnosis of cancer. In breast cancer, several miRNAs and their levels of expression are significantly different between normal tissue and tissue with neoplasia, as well as between different molecular subtypes of breast cancer, also associated with prognosis. Thus, this these presents a meta-analysis that allows identifying a reliable miRNA biomarker for the early detection of breast cancer. In this, miRNA-155 was identified as the best one and an electrochemical biosensor was developed for its detection in serum samples. The biosensor was assembled by following three button-up stages: (1) the complementary miRNA sequence thiol terminated (anti-miRNA-155) was immobilized on a commercial gold screen-printed electrode (Au-SPE), followed by (2) blocking non-specific binding with mercaptosuccinic acid and by (3) miRNA hybridization. The biosensor was able to detect miRNA concentrations lying in the 10-18 mol/L (aM) range, displaying a linear response from 10 aM to 1nM. The device showed a limit of detection of 5.7 aM in human serum samples and good selectivity against other biomolecules in serum, such as cancer antigen CA-15.3 and bovine serum albumin (BSA). Overall, this simple and sensitive strategy is a promising approach for the quantitative and/or simultaneous analysis of multiple miRNA in physiological fluids, aiming at further biomedical research devoted to biomarker monitoring and point-of-care diagnosis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Prostate cancer is a major cause of cancer death in Nigerian men. Attempts to reduce mortality from prostate cancer have focused mainly on early detection of the disease by the use of PSA testing. As a result of the increased incidence of prostate cancer in Nigeria despite the widespread availability of testing facilities, it became pertinent to understand the salient factors that prompt Nigerian men to go for prostate cancer testing. Objective: This study explores the factors that influence a group of Nigerian men’s decision to go for Prostate Specific Antigen (PSA) testing. Methods: Following ethical approval, semi structured interviews were conducted with a group of 10 men who had PSA test following consultation with their doctor with signs and symptoms at the University of Benin Teaching Hospital from July to August, 2010. Interview transcripts were analysed by employing steps proposed by Collaizi (1978). Results: Five themes were identified: the symptoms experienced, the influence of friends and relatives, older age associated with increased awareness, accessibility to testing services and the knowledge of the PSA test. Conclusion: The study revealed that there continues to be a considerable lack of awareness and knowledge about prostate cancer and screening.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

As an immune-inspired algorithm, the Dendritic Cell Algorithm (DCA), produces promising performance in the field of anomaly detection. This paper presents the application of the DCA to a standard data set, the KDD 99 data set. The results of different implementation versions of the DCA, including antigen multiplier and moving time windows, are reported. The real-valued Negative Selection Algorithm (NSA) using constant-sized detectors and the C4.5 decision tree algorithm are used, to conduct a baseline comparison. The results suggest that the DCA is applicable to KDD 99 data set, and the antigen multiplier and moving time windows have the same effect on the DCA for this particular data set. The real-valued NSA with contant-sized detectors is not applicable to the data set. And the C4.5 decision tree algorithm provides a benchmark of the classification performance for this data set.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.