951 resultados para moving object detection
Resumo:
Large read-only or read-write transactions with a large read set and a small write set constitute an important class of transactions used in such applications as data mining, data warehousing, statistical applications, and report generators. Such transactions are best supported with optimistic concurrency, because locking of large amounts of data for extended periods of time is not an acceptable solution. The abort rate in regular optimistic concurrency algorithms increases exponentially with the size of the transaction. The algorithm proposed in this dissertation solves this problem by using a new transaction scheduling technique that allows a large transaction to commit safely with significantly greater probability that can exceed several orders of magnitude versus regular optimistic concurrency algorithms. A performance simulation study and a formal proof of serializability and external consistency of the proposed algorithm are also presented.^ This dissertation also proposes a new query optimization technique (lazy queries). Lazy Queries is an adaptive query execution scheme which optimizes itself as the query runs. Lazy queries can be used to find an intersection of sub-queries in a very efficient way, which does not require full execution of large sub-queries nor does it require any statistical knowledge about the data.^ An efficient optimistic concurrency control algorithm used in a massively parallel B-tree with variable-length keys is introduced. B-trees with variable-length keys can be effectively used in a variety of database types. In particular, we show how such a B-tree was used in our implementation of a semantic object-oriented DBMS. The concurrency control algorithm uses semantically safe optimistic virtual "locks" that achieve very fine granularity in conflict detection. This algorithm ensures serializability and external consistency by using logical clocks and backward validation of transactional queries. A formal proof of correctness of the proposed algorithm is also presented. ^
Resumo:
[EN]In this paper, a basic conceptual architecture aimed at the design of Computer Vision System is qualitatively described. The proposed architecture addresses the design of vision systems in a modular fashion using modules with three distinct units or components: a processing network or diagnostics unit, a control unit and a communications unit. The control of the system at the modules level is designed based on a Discrete Events Model. This basic methodology has been used to design a realtime active vision system for detection, tracking and recognition of people. It is made up of three functional modules aimed at the detection, tracking, recognition of moving individuals plus a supervision module.
Resumo:
To gain a better understanding of the fluid–structure interaction and especially when dealing with a flow around an arbitrarily moving body, it is essential to develop measurement tools enabling the instantaneous detection of moving deformable interface during the flow measurements. A particularly useful application is the determination of unsteady turbulent flow velocity field around a moving porous fishing net structure which is of great interest for selectivity and also for the numerical code validation which needs a realistic database. To do this, a representative piece of fishing net structure is used to investigate both the Turbulent Boundary Layer (TBL) developing over the horizontal porous moving fishing net structure and the turbulent flow passing through the moving porous structure. For such an investigation, Time Resolved PIV measurements are carried out and combined with a motion tracking technique allowing the measurement of the instantaneous motion of the deformable fishing net during PIV measurements. Once the two-dimensional motion of the porous structure is accessed, PIV velocity measurements are analyzed in connection with the detected motion. Finally, the TBL is characterized and the effect of the structure motion on the volumetric flow rate passing though the moving porous structure is clearly demonstrated.
Resumo:
When performing Particle Image Velocimetry (PIV) measurements in complex fluid flows with moving interfaces and a two-phase flow, it is necessary to develop a mask to remove non-physical measurements. This is the case when studying, for example, the complex bubble sweep-down phenomenon observed in oceanographic research vessels. Indeed, in such a configuration, the presence of an unsteady free surface, of a solid–liquid interface and of bubbles in the PIV frame, leads to generate numerous laser reflections and therefore spurious velocity vectors. In this note, an image masking process is developed to successively identify the boundaries of the ship and the free surface interface. As the presence of the solid hull surface induces laser reflections, the hull edge contours are simply detected in the first PIV frame and dynamically estimated for consecutive ones. As for the unsteady surface determination, a specific process is implemented like the following: i) the edge detection of the gradient magnitude in the PIV frame, ii) the extraction of the particles by filtering high-intensity large areas related to the bubbles and/or hull reflections, iii) the extraction of the rough region containing these particles and their reflections, iv) the removal of these reflections. The unsteady surface is finally obtained with a fifth-order polynomial interpolation. The resulted free surface is successfully validated from the Fourier analysis and by visualizing selected PIV images containing numerous spurious high intensity areas. This paper demonstrates how this data analysis process leads to PIV images database without reflections and an automatic detection of both the free surface and the rigid body. An application of this new mask is finally detailed, allowing a preliminary analysis of the hydrodynamic flow.
Resumo:
Automatic analysis of human behaviour in large collections of videos is gaining interest, even more so with the advent of file sharing sites such as YouTube. However, challenges still exist owing to several factors such as inter- and intra-class variations, cluttered backgrounds, occlusion, camera motion, scale, view and illumination changes. This research focuses on modelling human behaviour for action recognition in videos. The developed techniques are validated on large scale benchmark datasets and applied on real-world scenarios such as soccer videos. Three major contributions are made. The first contribution is in the area of proper choice of a feature representation for videos. This involved a study of state-of-the-art techniques for action recognition, feature extraction processing and dimensional reduction techniques so as to yield the best performance with optimal computational requirements. Secondly, temporal modelling of human behaviour is performed. This involved frequency analysis and temporal integration of local information in the video frames to yield a temporal feature vector. Current practices mostly average the frame information over an entire video and neglect the temporal order. Lastly, the proposed framework is applied and further adapted to real-world scenario such as soccer videos. A dataset consisting of video sequences depicting events of players falling is created from actual match data to this end and used to experimentally evaluate the proposed framework.
Resumo:
Code patterns, including programming patterns and design patterns, are good references for programming language feature improvement and software re-engineering. However, to our knowledge, no existing research has attempted to detect code patterns based on code clone detection technology. In this study, we build upon the previous work and propose to detect and analyze code patterns from a collection of open source projects using NiPAT technology. Because design patterns are most closely associated with object-oriented languages, we choose Java and Python projects to conduct our study. The tool we use for detecting patterns is NiPAT, a pattern detecting tool originally developed for the TXL programming language based on the NiCad clone detector. We extend NiPAT for the Java and Python programming languages. Then, we try to identify all the patterns from the pattern report and classify them into several different categories. In the end of the study, we analyze all the patterns and compare the differences between Java and Python patterns.
Resumo:
Near-infrared polarimetry observation is a powerful tool to study the central sources at the center of the Milky Way. My aim of this thesis is to analyze the polarized emission present in the central few light years of the Galactic Center region, in particular the non-thermal polarized emission of Sagittarius~A* (Sgr~A*), the electromagnetic manifestation of the super-massive black hole, and the polarized emission of an infrared-excess source in the literature referred to as DSO/G2. This source is in orbit about Sgr~A*. In this thesis I focus onto the Galactic Center observations at $\lambda=2.2~\mu m$ ($K_\mathrm{s}$-band) in polarimetry mode during several epochs from 2004 to 2012. The near-infrared polarized observations have been carried out using the adaptive optics instrument NAOS/CONICA and Wollaston prism at the Very Large Telescope of ESO (European Southern Observatory). Linear polarization at 2.2 $\mu m$, its flux statistics and time variation, can be used to constrain the physical conditions of the accretion process onto the central super-massive black hole. I present a statistical analysis of polarized $K_\mathrm{s}$-band emission from Sgr~A* and investigate the most comprehensive sample of near-infrared polarimetric light curves of this source up to now. I find several polarized flux excursions during the years and obtain an exponent of about 4 for the power-law fitted to polarized flux density distribution of fluxes above 5~mJy. Therefore, this distribution is closely linked to the single state power-law distribution of the total $K_\mathrm{s}$-band flux densities reported earlier by us. I find polarization degrees of the order of 20\%$\pm$10\% and a preferred polarization angle of $13^o\pm15^o$. Based on simulations of polarimetric measurements given the observed flux density and its uncertainty in orthogonal polarimetry channels, I find that the uncertainties of polarization parameters under a total flux density of $\sim 2\,{\mathrm{mJy}}$ are probably dominated by observational uncertainties. At higher flux densities there are intrinsic variations of polarization degree and angle within rather well constrained ranges. Since the emission is most likely due to optically thin synchrotron radiation, the obtained preferred polarization angle is very likely reflecting the intrinsic orientation of the Sgr~A* system i.e. an accretion disk or jet/wind scenario coupled to the super-massive black hole. Our polarization statistics show that Sgr~A* must be a stable system, both in terms of geometry, and the accretion process. I also investigate an infrared-excess source called G2 or Dusty S-cluster Object (DSO) moving on a highly eccentric orbit around the Galaxy's central black hole, Sgr~A*. I use for the first time the near-infrared polarimetric imaging data to determine the nature and the properties of DSO and obtain an improved $K_\mathrm{s}$-band identification of this source in median polarimetry images of different observing years. The source starts to deviate from the stellar confusion in 2008 data and it does not show a flux density variability based on our data set. Furthermore, I measure the polarization degree and angle of this source and conclude based on the simulations on polarization parameters that it is an intrinsically polarized source with a varying polarization angle as it approaches Sgr~A* position. I use the interpretation of the DSO polarimetry measurements to assess its possible properties.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.