Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação das respostas autonomicas e cardiorrespiratorias de homens e mulheres de meia-idade antes e apos treinamento fisico aerobio

Universidade Estadual de Campinas . Faculdade de Educação Física

Corporeidade e cultura amazonica : re-flexões a partir do passaro junino do Para

Universidade Estadual de Campinas . Faculdade de Educação Física

Influência da largura do septo inter-radicular sobre a estabilidade dos mini-implantes

OBJETIVO: este estudo teve como objetivo avaliar a influência da largura do septo inter-radicular no local de inserção de mini-implantes autoperfurantes sobre o grau de estabilidade desses dispositivos de ancoragem. MÉTODOS: a amostra consistiu de 40 mini-implantes inseridos entre as raízes do primeiro molar e segundo pré-molar superiores de 21 pacientes, com o intuito de fornecer ancoragem para retração anterior. A largura do septo no local de inserção (LSI) foi mensurada nas radiografias pós-cirúrgicas e, sob esse aspecto, os mini-implantes foram divididos em dois grupos: grupo 1 (áreas críticas, LSI<3mm) e grupo 2 (áreas não críticas, LSI>3mm). A estabilidade dos mini-implantes foi avaliada mensalmente pela quantificação do grau de mobilidade e a partir dessa variável foi calculada a proporção de sucesso. Avaliou-se também: a quantidade de placa, altura de inserção, grau de sensibilidade e período de observação. RESULTADOS: os resultados obtidos demonstraram que não houve diferença estatisticamente significativa para o grau de mobilidade e proporção de sucesso entre os mini-implantes inseridos em septos de largura mesiodistal crítica e não crítica. A proporção de sucesso total encontrada foi de 90% e nenhuma variável demonstrou estar relacionada ao insucesso dos mini-implantes. No entanto, observou-se maior sensibilidade nos pacientes cujos mini-implantes apresentavam mobilidade, e que a falha desses dispositivos de ancoragem ocorria logo após sua inserção. CONCLUSÃO: a largura do septo inter-radicular no local de inserção não interferiu na estabilidade dos mini-implantes autoperfurantes avaliados neste estudo.

Dentin permeability of the apical third in different groups of teeth

This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.

Effectiveness of different final irrigation protocols in removing debris in flattened root canals

This study evaluated in vitro the capacity of debris removal from the apical third of flattened root canals, using different final irrigation protocols. Thirty human mandibular central incisors with a mesiodistal flattened root were prepared using rotary instrumentation by Endo-Flare 25.12 and Hero 642 30.06, 35.02, 40.02 files, irrigated with 2 mL of 1% NaOCl after each file. The specimens were randomly distributed into 5 groups according to the final irrigation of root canals: Group I: 10 mL of distilled water (control), Group II: 10 mL of 1% NaOCl for 8 min, Group III: 2 mL of 1% NaOCl for 2 min (repeated 4 times), Group IV: 10 mL of 2.5% NaOCl for 8 min, and Group V: 10 mL of 2.5% NaOCl for 2 min (repeated 4 times). The apical thirds of the specimens were subjected to histological processing and 6-μm cross-sections were obtained and stained with hematoxylin-eosin. The specimens were examined under optical microscopy at ×40 magnification and the images were subjected to morphometric analysis using the Scion image-analysis software. The total area of root canal and the area with debris were measured in square millimeters. Analysis of variance showed no statistically significant difference (p>0.05) among the groups GI (2.39 ± 3.59), GII (2.91 ± 2.21), GIII (0.73 ± 1.36), GIV (0.95 ± 0.84) and GV (0.51 ± 0.22). In conclusion, the final irrigation protocols evaluated in this study using the Luer syringe presented similar performance in the removal of debris from the apical third of flattened root canals.

Isolation and characterization of Flavobacterium columnare (Bernardet et al. 2002) from four tropical fish species in Brazil

Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.

Influência da expansão rápida da maxila na rizólise dos caninos decíduos usados como ancoragem

OBJETIVOS: o presente estudo radiográfico, retrospectivo e longitudinal objetivou determinar se a ancoragem do aparelho expansor fixo tipo Haas, modificado para as dentaduras decídua e mista, interfere na velocidade de rizólise e esfoliação dos caninos decíduos. MÉTODOS: foi feita uma avaliação quantitativa da rizólise do canino decíduo mediante a medição do comprimento coroa-ápice dos caninos decíduos superiores, dos lados direito e esquerdo. Para essa avaliação, 24 crianças submetidas à expansão rápida da maxila (ERM) na dentadura decídua ou no início da dentadura mista foram comparadas com 15 crianças que não passaram por esse procedimento. A medição do comprimento coroa-ápice dos caninos decíduos foi realizada com o programa computadorizado CEF-X Cefalometria Digital, produzido pela CDT Informática, que permitiu calibrar o tamanho dos dentes pela uniformização das imagens radiográficas digitalizadas. RESULTADOS: os dados estatísticos revelaram que não houve diferença na velocidade de rizólise dos caninos decíduos entre as crianças do grupo controle e as do grupo submetido à ERM. CONCLUSÕES: é possível inferir que o aparelho expansor fixo tipo Haas ancorado em dentes decíduos não influencia a rizólise dos caninos decíduos usados como ancoragem.

Previsões climáticas sazonais sobre o Brasil: avaliação do RegCM3 aninhado no modelo global CPTEC/COLA

Este trabalho avalia o desempenho de previsões sazonais do modelo climático regional RegCM3, aninhado ao modelo global CPTEC/COLA. As previsões com o RegCM3 utilizaram 60 km de resolução horizontal num domínio que inclui grande parte da América do Sul. As previsões do RegCM3 e CPTEC/COLA foram avaliadas utilizando as análises de chuva e temperatura do ar do Climate Prediction Center (CPC) e National Centers for Enviromental Prediction (NCEP), respectivamente. Entre maio de 2005 e julho de 2007, 27 previsões sazonais de chuva e temperatura do ar (exceto a temperatura do CPTEC/COLA, que possui 26 previsões) foram avaliadas em três regiões do Brasil: Nordeste (NDE), Sudeste (SDE) e Sul (SUL). As previsões do RegCM3 também foram comparadas com as climatologias das análises. De acordo com os índices estatísticos (bias, coeficiente de correlação, raiz quadrada do erro médio quadrático e coeficiente de eficiência), nas três regiões (NDE, SDE e SUL) a chuva sazonal prevista pelo RegCM3 é mais próxima da observada do que a prevista pelo CPTEC/COLA. Além disto, o RegCM3 também é melhor previsor da chuva sazonal do que da média das observações nas três regiões. Para temperatura, as previsões do RegCM3 são superiores às do CPTEC/COLA nas áreas NDE e SUL, enquanto o CPTEC/COLA é superior no SDE. Finalmente, as previsões de chuva e temperatura do RegCM3 são mais próximas das observações do que a climatologia observada. Estes resultados indicam o potencial de utilização do RegCM3 para previsão sazonal, que futuramente deverá ser explorado através de previsão por conjunto.

Physiological and biochemical characterization of the assai palm (Euterpe oleracea Mart.) during seed germination and seedling growth under aerobic and anaerobic conditions

Physiological and biochemical aspects of assai palm during seed germination and early seedling growth were investigated. Seeds collected from plants growing in flooded and upland forests were used to determine the influence of normoxic (aerobic) and anoxic (anaerobic) conditions in germination and the initial and average time of development in the roots and shoots. After 75 days, seedlings germinated under normoxia were transferred to trays and submitted to flooding. Seed reserves (lipids, proteins, soluble sugars and starch) were monitored for quiescent and germinated seeds maintained under normoxic and anoxic conditions, as well as after 5, 10 and 20 days of seedling growth. Alcohol dehydrogenase (ADH) activity was quantified in roots and leaves of seedlings without or with flooding (partial and total). Seeds were not able to germinate under anoxia. Different strategies of storage mobilization of lipids, proteins, soluble sugars and starch were observed in seeds of each environment. ADH activity was induced by anoxia, with the highest level observed in the leaves. This study showed that, under normoxic conditions, the best developmental performance of assai palm seeds, from flooded or upland forest areas, during germination was associated with primary metabolites mobilization and seedling flooding tolerance with increased ADH activity. We conclude that the assai palm is well adapted to the anoxic conditions provoked by flooding.

Morpho-Anatomical Analysis of the Rhizome in Species of Scleria Berg. (Cyperaceae) from Serra do Cipó (MG)

Aspects related to the nature of stem thickening in monocotyledons have been the subject of many studies. Primary thickening has been attributed to the Primary Thickening Meristem (PTM). According to most authors, it gives rise, besides the adventitious roots, to the vascular tissues and part of the cortex. In other words, it has centripetal and centrifugal activity. For some authors, however, it gives rise only to the vascular system, and for others, only to part of the cortex. However, this work demonstrated that PTM corresponds to the pericycle in the meristematic phase or to the pericycle associated with the endodermis, also with meristematic activity. It was observed that the pericycle was responsible for the formation of the vascular system of the rhizome and of the adventitious roots; the endodermis gave rise to cell layers with radial disposition which comprised the inner portion of the stem cortex, and which corresponded to the region known as the derivatives of the meristematic endodermis (DME). A continuity was also demonstrated between the tissues of the stem and root in species of Scleria Berg. (Cyperaceae).

Reproductive behavior, development and eye regression in the cave armored catfish, Ancistrus cryptophthalmus Reis, 1987 (Siluriformes: Loricariidae), breed in laboratory

The troglobitic armored catfish, Ancistrus cryptophthalmus (Loricariidae, Ancistrinae) is known from four caves in the São Domingos karst area, upper rio Tocantins basin, Central Brazil. These populations differ in general body shape and degree of reduction of eyes and of pigmentation. The small Passa Três population (around 1,000 individuals) presents the most reduced eyes, which are not externally visible in adults. A small group of Passa Três catfish, one male and three females, reproduced spontaneously thrice in laboratory, at the end of summertime in 2000, 2003 and 2004. Herein we describe the reproductive behavior during the 2003 event, as well as the early development of the 2003 and 2004 offsprings, with focus on body growth and ontogenetic regression of eyes. The parental care by the male, which includes defense of the rock shelter where the egg clutch is laid, cleaning and oxygenation of eggs, is typical of many loricariids. On the other hand, the slow development, including delayed eye degeneration, low body growth rates and high estimated longevity (15 years or more) are characteristic of precocial, or K-selected, life cycles. In the absence of comparable data for close epigean relatives (Ancistrus spp.), it is not possible to establish whether these features are an autapomorphic specialization of the troglobitic A. cryptophthalmus or a plesiomorphic trait already present in the epigean ancestor, possibly favoring the adoption of the life in the food-poor cave environment. We briefly discuss the current hypotheses on eye regression in troglobitic vertebrates.

O sincretismo de culturas sob a ótica da arquitetura vernácula do imigrante japonês na cidade de Registro, São Paulo

O presente artigo aborda os métodos construtivos empregados pelos imigrantes japoneses que vieram, em 1918, para a cidade de Registro, na região do Vale do Ribeira do Iguape, no estado de São Paulo. A vinda dessa nova frente de imigração foi incentivada pelo Governo do Estado, com o propósito de promover o processo de colonização, bem como de estimular o desenvolvimento econômico do Vale do Ribeira do Iguape por meio da expansão da cultura do café para a região. As características dessa frente de imigração são muito diferenciadas em relação às demais, tendo em vista que os que dela faziam parte chegaram ao Brasil como proprietários de terras e com apoio financeiro e logístico oferecido por uma empresa particular japonesa, responsável por gerenciar o empreendimento. Esses imigrantes, portanto, contaram com auxílio de uma complexa infra-estrutura, cujo objetivo era viabilizar a sua missão de desenvolvimento da região. Mesmo tendo essa particularidade lhes proporcionado a liberdade de recriar sua cultura em solo brasileiro, a realidade do novo habitat forçou-os a reinterpretar seus hábitos culturais ante as novas circunstâncias físicas, econômicas e sociais encontradas. A fim de entender esse processo de adaptação, foi realizado um estudo dos métodos construtivos empregados em suas edificações, baseado nos conhecimentos desses imigrantes sobre sua arquitetura tradicional. Essa análise permitiu examinar o longo processo de sincretismo entre a cultura oriental e o conhecimento construtivo vernáculo dos habitantes do Vale do Ribeira do Iguape.

Epilithic community development on artificial reefs deployed along a cross-shelf environmental gradient off Paraná state, southern Brazil

Concrete modules were deployed on the bottom of the 11, 18 and 30 meters isobaths along a cross-shelf hydrographic gradient off Paraná State, Southern Brazil, with the purpose of studying the colonization of sessile epilithic macroinvertebrates on artificial surfaces. After one year of submersion a total of 63 species of epilithic organisms were identified, dominated by Ostrea puelchana, Chthamalus bisinuatus, Balanus cf spongicola, Astrangia cf rathbuni, Didemnum spp, poryphers and bryozoans. Diversity index and percent cover at reef stations placed at 11, 18 and 30 meters isobaths were respectively 2.28 and 66.7%, 2.79 and 96.6% and 1.66 and 77.4%. Differences of general community structure among the three assemblages were not clearly related to the general environmental conditions at the bottom layers near the reef stations. Turbidity and larval abundance are discussed as important factors affecting colonization processes. Results indicate that depths between 15-20 meters are more suitable for the implementation of large scale artificial reef systems in the inner shelf off Paraná and, possibly, throughout the inner shelves off southern Brazil with similar hydrographic conditions.

Analysis of mangrove forest succession, using sediment cores: a case study in the Cananéia -Iguape coastal system, São Paulo Brazil

Sediment cores are an essential tool for the analysis of the dynamics of mangrove succession. Coring was used to correlate changes in depositional environments and lateral sedimentary facies with discrete stages of forest succession at the Cananéia-Iguape Coastal System in southeastern Brazil. A local level successional pattern was examined based on four core series T1) a sediment bank; T2) a smooth cordgrass Spartina alterniflora bank; T3) an active mangrove progradation fringe dominated by Laguncularia racemosa, and; T4) a mature mangrove forest dominated by Avicennia schaueriana. Cores were macroscopically described in terms of color, texture, sedimentary structure and organic components. The base of all cores exhibited a similar pattern suggesting common vertical progressive changes in depositional conditions and subsequent successional colonization pattern throughout the forest. The progradation zone is an exposed bank, colonized by S. alterniflora. L. racemosa, replaces S. alterniflora as progradation takes place. As the substrate consolidates A. schaueriana replaces L. racemosa and attains the greatest structural development in the mature forest. Cores collected within the A. schaueriana dominated stand contained S. alterniflora fragments near the base, confirming that a smooth cordgrass habitat characterized the establishment and early seral stages. Cores provide a reliable approach to describe local-level successional sequences in dynamic settings subject to drivers operating on multiple temporal and spatial scales where spatial heterogeneity can lead to multiple equilibria and where similar successional end-points may be reached through convergent paths.