Prospecção gênica e diversidade bacteriana de um consórcio degradador de óleo diesel

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Levantamento das principais viroses na cultura do alho (Allium sativum L.) e caracterização de carlavirus em algumas regiões produtoras do Brasil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Ocorrência de viroses em mandioquinha-salsa (Arracacia xanthorrhiza brancroft) nas principais regiões produtoras do Brasil

Pós-graduação em Agronomia (Proteção de Plantas) - FCA

Caracterização morfológica, morfométrica e molecular de Hepatozoon spp. (Apicomplexa, Hepatozoidae) de serpentes brasileiras naturalmente infectadas

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Expressão gênica diferencial por cDNA-AFLP em raízes de cana-de-açúcar submetida ao déficit hídrico

Pós-graduação em Agronomia (Genética e Melhoramento de Plantas) - FCAV

Identificação e análise da expressão de genes relacioanados com tolerância à seca em soja através de microarranjos de DNA e PCR em tempo real

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Dinâmica populacional de minicírculos de cinetoplastos em Leishmania infantum chagasi

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Sequenciamento de DNA e imunoistoquímica renal para detecção de Leishmania sp em cães

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

DDRT-PCR approaches applied for preeminent results in the isolation of DETs from fish brain tissues

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação da diluição do DNA extraido de material parafinado para amplificação em PCR

Introduction: Several reasons may lead to the failure of polymerase chain reaction (PCR) using DNA purified from paraffin-embedded materials: presence of inhibitors and degradation of target DNA. DNA dilution will often reduce the concentration of potential inhibitors and still contain enough DNA to allow PCR amplification. Objective: To evaluate the dilution influence of DNA purified from paraffin-embedded materials on β-globin PCR amplification. Material and Method: Paraffin-embedded blocks from 30 patients with oropharynx squamous cell carcinomas, diagnosed and treated at the Oral Oncology Center were selected. DNA extraction was performed using QIAmp minikit (Quiagen). DNA was quantified and evaluated for purity by spectrophotometer analysis. Two groups were formed with different amounts of DNA: group I had the originally extracted DNA and group II had the same DNA, however diluted with ultrapure water addition. PCR was performed in both groups using oligonucleotides for human β-globin gene. Results: For Group I, amplification of the β-globin gene sequence was successful in 33.33% of the samples and for Group II, in 23.33%. Conclusion: Dilution of the DNA extracted of paraffin-embedded materials did not modify statistically the amount of positive samples β-globin gene amplified in PCR, although the results suggest that this is a way to increase the method for efficacy amplification of PCR.

Comparação entre dois métodos de detecção de DNA de papilomavírus humano em carcinoma epidermoide de lábio

Introdução: Recentemente o papilomavírus humano (HPV) tem sido associado à carcinogênese oral. A metodologia empregada na detecção do vírus é uma das maiores causas observadas da grande variabilidade nas taxas de detecção do HPV. Objetivo: Este estudo comparou a sensibilidade de detecção do DNA do HPV em casos de carcinoma epidermoide de lábio utilizando a amplificação do DNA viral por reação em cadeia da polimerase (PCR) ou nPCR. Material e método: Foram utilizadas 33 amostras provenientes de casos de carcinoma epidermoide de lábio. Para as extrações do DNA utilizou-se o sistema QIAamp DNA Mini Kit. Como controle interno utilizou-se o gene da b-globina. Das 33 amostras iniciais, 30 foram positivas para o gene b-globina, sendo utilizadas para detectar o DNA viral. Comparou-se a amplificação do DNA viral pelos métodos da PCR com os oligonucleotídeos MY09/MY11 e nPCR, empregando-se os pares de oligonucleotídeos iniciadores MY09/MY11 e, na segunda etapa, o par GP5+/GP6+. O controle positivo para a presença do DNA do HPV utilizado foi a linhagem de células HeLa e, como controle negativo, a mistura de amplificação sem DNA. A análise dos produtos de PCR e nPCR para HPV foi realizada por eletroforese em gel de poliacrilamida a 8%. Resultados: Utilizando-se o método da PCR, a amplificação do DNA do HPV foi constatada em dois casos. Com a nPCR foi verificada presença de DNA viral em 13 das 30 amostras. Conclusão: Com a utilização da nPCR, a detecção do HPV nos casos estudados aumentou mais de seis vezes.

Comparação de métodos para extração de dna na reação em cadeia da polimerase para detecção de Salmonella enterica sorovar enteritidis em produtos avícolas

The identification of Salmonella spp. in food samples by microbiological diagnosis is time consuming, with approximately five different stages, requiring about 120 hours until the final result. The utilization of the polymerase chain reaction technique (PCR) can reduce this time, but substances present in samples may affect the reaction. The present work aimed to compare DNA extraction by thermic treatment and by the use of cetyltrimethil ammonium bromide (CTAB), in products originated from poultry houses corresponding to raw material (meat meal) and experimentally contaminated drag swabs. Materials obtained from the extractions were submitted to PCR, utilizing a pair of initiator oligonucleotides for amplification of Sdf 1 gene fragments. Comparing the methods of extraction, it was observed that when CTAB was employed, SE was detected in 70% of meat meal and in 80% of drag swabs, while the thermic treatment method yielded positive results in 20% of meat meal and in 40% of drag swabs. SE was detected under both methods utilized for DNA extraction, but the use of CTAB detected a greater number of positive samples, compared with thermal treatment.

Theoretical and Experimental Studies in Nuclear Magnetic Resonance

Nuclear magnetic resonance (NMR) is a tool used to probe the physical and chemical environments of specific atoms in molecules. This research explored small molecule analogues to biological materials to determine NMR parameters using ab initio computations, comparing the results with solid-state NMR measurements. Models, such as dimethyl phosphate (DMP) for oligonucleotides or CuCl for the active site of the protein azurin, represented computationally unwieldy macromolecules. 31P chemical shielding tensors were calculated for DMP as a function of torsion angles, as well as for the phosphate salts, ammonium dihydrogen phosphate (ADHP), diammonium hydrogen phosphate, and magnesium dihydrogen phosphate. The computational DMP work indicated a problem with the current standard 31P reference of 85% H3PO4(aq.). Comparison of the calculations and experimental spectra for the phosphate salts indicated ADHP might be a preferable alternative as a solid state NMR reference for 31P. Experimental work included magic angle spinning experiments on powder samples using the UNL chemistry department’s Bruker Avance 600 MHz NMR to collect data to determine chemical shielding anisotropies. For the quadrupolar nuclei of copper and scandium, the electric field gradient was calculated in diatomic univalent metal halides, allowing determination of the minimal level of theory necessary to compute NMR parameters for these nuclei.

Revised Diagnostic Criteria for Vogt-Koyanagi-Harada Disease: Considerations on the Different Disease Categories

PURPOSE: To evalulate the applicability of the Revised Diagnostic Criteria for Vogt-Koyanagi-Harada (VKH) disease to Brazilian patients and to verify the association between different disease categories, clinical parameters, and the presence of HLA-DRB1*0405. DESIGN: A retrospective observational case series. METHODS: Medical charts of 67 patients (10 to 64 years in age; 12 men and 55 women), from the Uveitis Service, Hospital das Clinicas, University of Sao Paulo School of Medicine (HCFMUSP), Sao Paulo, Brazil were reviewed. Patients, previously diagnosed with VKH disease using criteria proposed by the American Uveitis Society, underwent retrospective classification based on the Revised Diagnostic Criteria. The degree of concordance was assessed. At presentation, 46 patients (69%) were in the early phase. In this group, the mean time from disease onset to treatment was 15 days (range, one to 30 days). Forty-eight patients (72%) were typed for HLA-DRB1*0405 by polymerase chain reaction-sequence specific primer and polymerase chain reaction,sequence, specific oligonucleotides primer. Disease categories, phase at initial presentation, and ocular complications were analyzed. RESULTS: There was a 100% of concordance between the two criteria. Disease was classified as complete in 10 patients (15%), incomplete in 37 patients (55%), and probable in 20 patients (30%). In each group, respectively, 90%, 76%, and 45% were in the early phase at presentation (P = .017). There was no association between disease categories, the presence of HLA-DRB1*0405, and clinical parameters. CONCLUSION. The Revised Diagnostic Criteria proved useful for diagnosis of VKH disease in Brazilian patients. The present retrospective study did not find any association between disease category and severity parameters. To better understand the relevance of disease categories, a minimum follow-up period to categorize patients should be included in future prospective studies. (Am J Ophthalmol 2009;147:339-345. (C) 2009 by Elsevier Inc. All rights reserved.)