Establishment of a PCR and restriction enzyme assay for the detection of the hemochromatosis gene in normal subjects and diabetic patients

The purpose of this study was to establish a polymerase chain reaction (PCR)-restriction enzyme assay for detecting the hereditary hemochromatosis (HHC) mutation, C282Y, in gestational and gestational diabetic subjects in South Florida. DNA samples from 43 gestational subjects were amplified by PCR, digested with RsaI, and analyzed by electrophoresis. An allelic frequency of 2.33%, or 4.65% heterozygosity, was observed. The assay is successful and applicable to future studies on HHC and gestational diabetes. ^

Variation in pre-PCR processing of FFPE samples leads to discrepancies in BRAF and EGFR mutation detection: a diagnostic RING trial.

AIMS: Mutation detection accuracy has been described extensively; however, it is surprising that pre-PCR processing of formalin-fixed paraffin-embedded (FFPE) samples has not been systematically assessed in clinical context. We designed a RING trial to (i) investigate pre-PCR variability, (ii) correlate pre-PCR variation with EGFR/BRAF mutation testing accuracy and (iii) investigate causes for observed variation. METHODS: 13 molecular pathology laboratories were recruited. 104 blinded FFPE curls including engineered FFPE curls, cell-negative FFPE curls and control FFPE tissue samples were distributed to participants for pre-PCR processing and mutation detection. Follow-up analysis was performed to assess sample purity, DNA integrity and DNA quantitation. RESULTS: Rate of mutation detection failure was 11.9%. Of these failures, 80% were attributed to pre-PCR error. Significant differences in DNA yields across all samples were seen using analysis of variance (p

Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936.

In a European BIOMED-2 collaborative study, multiplex PCR assays have successfully been developed and standardized for the detection of clonally rearranged immunoglobulin (Ig) and T-cell receptor (TCR) genes and the chromosome aberrations t(11;14) and t(14;18). This has resulted in 107 different primers in only 18 multiplex PCR tubes: three VH-JH, two DH-JH, two Ig kappa (IGK), one Ig lambda (IGL), three TCR beta (TCRB), two TCR gamma (TCRG), one TCR delta (TCRD), three BCL1-Ig heavy chain (IGH), and one BCL2-IGH. The PCR products of Ig/TCR genes can be analyzed for clonality assessment by heteroduplex analysis or GeneScanning. The detection rate of clonal rearrangements using the BIOMED-2 primer sets is unprecedentedly high. This is mainly based on the complementarity of the various BIOMED-2 tubes. In particular, combined application of IGH (VH-JH and DH-JH) and IGK tubes can detect virtually all clonal B-cell proliferations, even in B-cell malignancies with high levels of somatic mutations. The contribution of IGL gene rearrangements seems limited. Combined usage of the TCRB and TCRG tubes detects virtually all clonal T-cell populations, whereas the TCRD tube has added value in case of TCRgammadelta(+) T-cell proliferations. The BIOMED-2 multiplex tubes can now be used for diagnostic clonality studies as well as for the identification of PCR targets suitable for the detection of minimal residual disease.

Real-Time PCR Assays for the Detection of Puccinia psidii

Puccinia psidii (Myrtle rust) is an emerging pathogen that has a wide host range in the Myrtaceae family; it continues to show an increase in geographic range and is considered to be a significant threat to Myrtaceae plants worldwide. In this study, we describe the development and validation of three novel real-time polymerase reaction (qPCR) assays using ribosomal DNA and β-tubulin gene sequences to detect P. psidii. All qPCR assays were able to detect P. psidii DNA extracted from urediniospores and from infected plants, including asymptomatic leaf tissues. Depending on the gene target, qPCR was able to detect down to 0.011 pg of P. psidii DNA. The most optimum qPCR assay was shown to be highly specific, repeatable, and reproducible following testing using different qPCR reagents and real-time PCR platforms in different laboratories. In addition, a duplex qPCR assay was developed to allow coamplification of the cytochrome oxidase gene from host plants for use as an internal PCR control. The most optimum qPCR assay proved to be faster and more sensitive than the previously published nested PCR assay and will be particularly useful for high-throughput testing and to detect P. psidii at the early stages of infection, before the development of sporulating rust pustules.

A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples

Diagnostic techniques based on PCR have two major problems: false-positive reactions due to contamination with DNA fragments from previous PCRs (amplicons) and false-negative reactions caused by inhibitors that interfere with the PCR. We have improved our previously reported PCR based on the amplification of a fragment of the Mycobacterium tuberculosis complex-specific insertion element IS6110 with respect to both problems. False-positive reactions caused by amplicon contamination were prevented by the use of uracil-N-glycosylase and dUTP instead of dTTP. We selected a new set of primers outside the region spanned by the formerly used primers to avoid false-positive reactions caused by dTTP-containing amplicons still present in the laboratory. With this new primer set, 16 copies of the IS6110 insertion element, the equivalent of two bacteria, could be amplified 10(10) times in 40 cycles, resulting in a mean efficiency of 77% per cycle. To detect the presence of inhibitors of the Taq polymerase, which may cause false-negative reactions, part of each sample was spiked with M. tuberculosis DNA. The DNA purification method using guanidinium thiocyanate and diatoms effectively removed most or all inhibitors of the PCR. However, this was not suitable for blood samples, for which we developed a proteinase K treatment followed by phenol-chloroform extraction. This method permitted detection of 20 M. tuberculosis bacteria per ml of whole blood. Various laboratory procedures were introduced to reduce failure or inhibition of PCR and avoid DNA cross contamination. We have tested 218 different clinical specimens obtained from patients suspected of having tuberculosis. The samples included sputum (n=145), tissue biopsy samples (n=25), cerebrospinal fluid (n=15), blood (n=14), pleural fluid (n=9), feces, (n=7), fluid from fistulae (n=2), and pus from a wound (n=1). The results obtained by PCR were consistent with those obtained with culture, which is the "gold standard." We demonstrate that PCR is a useful technique for the rapid diagnosis of tuberculosis at various sites.

A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2)

As key prey, the wild rabbit downsize constitutes a major drawback on the endangered Iberian lynx (Lynx pardinus) re-introduction in the Iberia. Several captive breeding units mostly located in Alentejo, endeavour the wild rabbit repopulation of depleted areas assigned for the lynx re-introduction. Here we report an RHDV2 outbreak that occurred in early 2016 in a wild rabbit captive breeding unit located in Barrancos municipality. The estimated mortality rate between March and April 2016 was approximately 8.67%. Anatomopathologic examination was carried out for 13 victimized rabbits. Molecular characterization was based on the complete vp60 capsid gene. The 13 rabbit carcasses investigated showed typical macroscopic RHD lesions testing positive to RHDV2- RNA. Comparison of the vp60 nucleotide sequences obtained from two specimens with others publically available disclosed similarities below 98.22% with RHDV2 strains originated in the Iberia and Azores and revealed that the two identical strains from Barrancos-2016 contain six unique single synonymous nucleotide polymorphisms. In the phylogenetic analysis performed, the Barrancos-2016 strains clustered apart from other known strains, meaning they may represent new evolutionary RHDV2 lineages. No clear epidemiological link could be traced for this outbreak where the mortalities were lower compared with previous years. Yet, network analysis suggested a possible connection between the missing intermediates from which the strains from Barrancos 2013, 2014 and 2016 have derived. It is therefore possible that RHDV2 has circulated endemically in the region since 2012, with periodic epizootic occurrences. Still, six years after its emergence in wild rabbits, RHDV2 continues to pose difficulties to the establishment of natural wild rabbit populations that are crucial for the self-sustainability of the local ecosystems.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Sensitivity evaluation of a single-step PCR assay using Ehrlichia canis p28 gene as a target and its application in diagnosis of canine ehrlichiosis

The aim of this study was to optimize a PCR assay that amplifies an 843 pb fragment from the p28 gene of Ehrlichia canis and compare it with two other PCR methods used to amplify portions of the 16S rRNA and dsb genes of Ehrlichia. Blood samples were collected from dogs suspected of having a positive diagnosis for canine ehrlichiosis. Amplification of the p28 gene by PCR produced an 843-bp fragment and this assay could detect DNA from one gene copy among 1 billion cells. All positive samples detected by the p28-based PCR were also positive by the 16S rRNA nested-PCR and also by the dsb-based PCR. Among the p28-based PCR negative samples, 55.3% were co-negatives, but 27.6% were positive in 16S rRNA and dsb based PCR assays. The p28-based PCR seems to be a useful test for the molecular detection of E. canis, however improvements in this PCR sensitivity are desired, so that it can become an important alternative in the diagnosis of canine ehrlichiosis.

Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10ºC and 27ºC) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27ºC and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures.

Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil

The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co-infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

Detection of Mycobacterium avium in pet birds

The present study is a report on the presence of Mycobacterium avium in four birds of the psittaciform order kept as pets. Anatomopathological diagnosis showed lesions suggestive of the agent and presence of alcohol-acid resistant bacilli (AARB) shown by the Ziehl-Neelsen staining. The identification of Mycobacterium avium was performed by means of PRA (PCR Restriction Analysis). DNA was directly extracted from tissue of the lesions and blocked in paraffin. The role of this agent in pet bird infection is discussed, as well as its zoonotic potential.

Detection of metallo-'beta'-lactamases-encoding genes in environmental isolates of Aeromonas hydrophila and Aeromonas jandaei

Aims: To determine the prevalence and expression of metallo-beta-lactamases (MBL)-encoding genes in Aeromonas species recovered from natural water reservoirs in southeastern Brazil. Methods and Results: Eighty-seven Aeromonas isolates belonging to Aeromonas hydrophila (n = 41) and Aer. jandaei (n = 46) species were tested for MBL production by the combined disk test using imipenem and meropenem disks as substrates and EDTA or thioglycolic acid as inhibitors. The presence of MBL genes was investigated by PCR and sequencing using new consensus primer pairs designed in this study. The cphA gene was found in 97.6% and 100% of Aer. hydrophila and Aer. jandaei isolates, respectively, whereas the acquired MBL genes bla(IMP), bla(VIM) and bla(SPM-1) were not detected. On the other hand, production of MBL activity was detectable in 87.8% and 10.9% of the cphA-positive Aer. hydrophila and Aer. jandaei isolates respectively. Conclusions: Our results indicate that cphA seems to be intrinsic in the environmental isolates of Aer. hydrophila and Aer. jandaei in southeastern Brazil, although, based on the combined disk test, not all of them are apparently able to express the enzymatic activity. Significance and Impact of the Study: These data confirm the presence of MBL-producing Aeromonas species in natural water reservoirs. Risk of water-borne diseases owing to domestic and industrial uses of freshwater should be re-examined from the increase of bacterial resistance point of view