The non-palindromic adaptor-PCR method for the identification of the T-cell receptor genes of an interferon-gamma-secreting T-cell hybridomaspecific for trans-sialidase, an immunodominant Trypanosoma cruzi antigen

Cloning of the T-cell receptor genes is a critical step when generating T-cell receptor transgenic mice. Because T-cell receptor molecules are clonotypical, isolation of their genes requires reverse transcriptase-assisted PCR using primers specific for each different Valpha or Vß genes or by the screening of cDNA libraries generated from RNA obtained from each individual T-cell clone. Although feasible, these approaches are laborious and costly. The aim of the present study was to test the application of the non-palindromic adaptor-PCR method as an alternative to isolate the genes encoding the T-cell receptor of an antigen-specific T-cell hybridoma. For this purpose, we established hybridomas specific for trans-sialidase, an immunodominant Trypanosoma cruzi antigen. These T-cell hybridomas were characterized with regard to their ability to secrete interferon-gamma, IL-4, and IL-10 after stimulation with the antigen. A CD3+, CD4+, CD8- interferon-gamma-producing hybridoma was selected for the identification of the variable regions of the T-cell receptor by the non-palindromic adaptor-PCR method. Using this methodology, we were able to rapidly and efficiently determine the variable regions of both T-cell receptor chains. The results obtained by the non-palindromic adaptor-PCR method were confirmed by the isolation and sequencing of the complete cDNA genes and by the recognition with a specific antibody against the T-cell receptor variable ß chain. We conclude that the non-palindromic adaptor-PCR method can be a valuable tool for the identification of the T-cell receptor transcripts of T-cell hybridomas and may facilitate the generation of T-cell receptor transgenic mice.

Effect of metabolic control on interferon-gamma and interleukin-10 production by peripheral blood mononuclear cells from type 1 and type 2 diabetic patients

The objective of the present study was to evaluate the production of cytokines, interferon-g (INF-g) and interleukin-10 (IL-10), in cultures of peripheral blood mononuclear cells (PBMC) from type 1 and type 2 diabetic patients and to correlate it with inadequate and adequate metabolic control. We studied 11 type 1 and 13 type 2 diabetic patients and 21 healthy individuals divided into two groups (N = 11 and 10) paired by sex and age with type 1 and type 2 diabetic patients. The PBMC cultures were stimulated with concanavalin-A to measure INF-g and IL-10 supernatant concentration by ELISA. For patients with inadequate metabolic control, the cultures were performed on the first day of hospitalization and again after intensive treatment to achieve adequate control. INF-g levels in the supernatants of type 1 diabetic patient cultures were higher compared to type 2 diabetic patients with adequate metabolic control (P < 0.001). Additionally, INF-g and IL-10 tended to increase the liberation of PBMC from type 1 and 2 diabetic patients with adequate metabolic control (P = 0.009 and 0.09, respectively). The increased levels of INF-g and IL-10 released from PBMC of type 1 and 2 diabetic patients with adequate metabolic control suggest that diabetic control improves the capacity of activation and maintenance of the immune response, reducing the susceptibility to infections.

Genetic polymorphisms in vitamin D receptor, vitamin D-binding protein, Toll-like receptor 2, nitric oxide synthase 2, and interferon-γ genes and its association with susceptibility to tuberculosis

Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10), nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP). The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

Interleukin-10-dependent down-regulation of interferon-gamma response to Leishmania by Mycobacterium leprae antigens during the clinical course of a coinfection

We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-γ) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-γ and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-γ response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.

Effects of single-dose atorvastatin on interleukin-6, interferon gamma, and myocardial no-reflow in a rabbit model of acute myocardial infarction and reperfusion

The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-γ) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-γ in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.

Teores de retinol, beta-caroteno e alfa-tocoferol em leites bovinos comercializados na cidade de São Paulo

Os teores de retinol, beta-caroteno e alfa-tocoferol foram determinados por cromatografia líquida de alta eficiência em leites em pó, pasteurizados e esterilizados, comercializados na Cidade de São Paulo. Após a saponificação e extração, os compostos foram determinados simultaneamente utilizando-se coluna de sílica, fase móvel constituída por hexano:isopropanol (99:1) e fluxo de 2,0mL/min. O retinol e o beta-caroteno foram determinados no detector UV/visível e o alfa-tocoferol no detector de fluorescência, ligado em série com o anterior. Os valores de vitamina A dos leites foram calculados com e sem a consideração do beta-caroteno. A maior contribuição deste nutriente no valor de vitamina A esteve entre os leites em pó, cerca de 17% em uma das marcas. Os altos teores das vitamina A e E encontrados em alguns leites, indicam que os mesmos provavelmente receberam adição destas vitaminas, não trazendo, entretanto, tal informação no rótulo. A análise de vitaminas nestes produtos indica a necessidade de maior controle de qualidade dos mesmos.

CONFIRMAÇÃO DA IDENTIDADE DA alfa-CRIPTOXANTINA E INCIDÊNCIA DE CAROTENÓIDES MINORITÁRIOS PROVITAMÍNICOS A EM VERDURAS FOLHOSAS VERDES

Numerosos trabalhos comprovaram que os carotenóides principais de folhas verdes são invariavelmente luteína, beta-caroteno, violaxantina e neoxantina. No entanto, há discordância em torno dos carotenóides minoritários. Portanto, a espectrometria de massas por impacto de elétrons e cromatografia líquida de alta eficiência com detector de arranjo de diodos foram utilizados para confirmar a identidade de carotenóides minoritários com atividade provitamínica A em verduras folhosas brasileiras. Os carotenóides pró-vitamínicos A, incluindo os isômeros cis e trans de beta-caroteno, foram separados em coluna de C18 polimérica, Vydac 201TP54, com metanol/água (98:2) como fase móvel. Os espectros UV-visível e de massas confirmaram o carotenóide monoidroxilado como sendo alfa-criptoxantina e não beta-criptoxantina como aponta a literatura internacional. Todas as onze folhas analisadas (agrião, alface crespa, alface lisa, almeirão, caruru, chicória, couve, espinafre, rúcula, salsinha e taioba) apresentaram alfa-criptoxantina, 13-cis-beta-caroteno e 9-cis-beta-caroteno, enquanto que alfa-caroteno foi encontrado em apenas quatro folhas (caruru, couve, salsinha e taioba).

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Padrões eletroforéticos da enzima alfa-amilase em sementes de milho submetidas a alta temperatura de secagem

Importantes mudanças fisiológicas e bioquímicas têm sido estudadas em sementes de milho submetidas a alta temperatura de secagem. O objetivo dessa pesquisa foi avaliar o efeito da secagem a alta temperatura nos padrões eletroforéticos da enzima a -amilase em sementes de linhagens, de híbridos simples e respectivos recíprocos. As sementes foram colhidas com teor de água de aproximadamente 35% e secadas a 45º C. A qualidade fisiológica das sementes de cada material foi avaliada pelo teste de germinação e a enzima alfa-amilase foi extraída de sementes germinadas, em tampão Tris-HCl 0,2 M. Sementes das linhagens secadas à sombra foram utilizadas como testemunha. Os perfis isoenzimáticos para a alfa-amilase revelaram uma maior intensidade de banda para as sementes das linhagens e de híbridos tolerantes a alta temperatura de secagem. Para as linhagens tolerantes a alta temperatura de secagem nenhuma diferença foi observada na atividade da enzima nas sementes secadas à sombra e artificialmente, o que já não ocorreu para as linhagens intolerantes, para as quais maior atividade foi verificada para as sementes secadas naturalmente. Foram observadas ainda diferenças na atividade da enzima alfa-amilase em sementes híbridas e nas dos seus respectivos recíprocos.

Caracterização de alfa-galactosidase em embrião e cotilédones de sementes de Platymiscium pubescens Micheli, var. pubecens (tamboril-da-mata)

Sementes de Platymiscium pubescens foram colocadas para embeber em água, sendo retiradas amostras para as caracterizações bioquímica e cinética da enzima alfa-galactosidase do eixo embrionário e dos cotilédones. A atividade específica no eixo embrionário aumenta de zero até o tempo de 96 horas de embebição, estabilizando em seguida. A atividade da enzima dos cotilédones mostrou pequeno incremento durante esse mesmo tempo. A alfa-galactosidase do eixo embrionário apresentou atividade máxima no intervalo de pH de 4,5 a 6,0. Por outro lado, para a enzima proveniente dos cotilédones, a maior atividade foi detectada na faixa de 4,0 a 6,0. A temperatura de 55ºC foi a que mais estimulou as atividades da alfa-galactosidase do eixo embrionário e dos cotilédones. As enzimas do eixo embrionário e dos cotilédones mostraram-se termotolerantes, não se alcançando a meia vida na temperatura de 40ºC, no período de 1.500 minutos. A atividade da alfa-galactosidase do eixo embrionário foi inibida por melibiose, CuSO4 e SDS, enquanto a dos cotilédones foi por todos os efetores, exceto com SDS, CuSO4 e galactose que tiveram efeito neutro sobre a atividade da alfa-galactosidase dos cotilédones. Os valores de K M para as alfa-galactosidases do embrião e para o cotilédone foram 3,37 e 0,26 mM, respectivamente.

Alterações nas atividades das enzimas alfa-galactosidase e poligalacturonase e nas reservas de carboidratos de sementes de Schizolobium parahyba (vell.) Blake (guapuruvú) durante a germinação

A retomada do metabolismo do embrião durante a germinação é realizada por processos metabólicos que culminam na protrusão da radícula e no fornecimento de energia para o desenvolvimento inicial da plântula. O objetivo deste trabalho foi estudar as variações nas atividades das enzimas alfa-galactosidase e poligalacturonase e nas reservas de mono e oligossacarídeos em sementes de guapuruvú durante a germinação. Para tanto, as sementes foram colocadas para germinar e as reservas do eixo embrionário e cotilédones, avaliadas periodicamente. Os teores de galactose no eixo embrionário diferiram significativamente somente entre a testemunha e o oitavo dia, muito embora houvesse aumento contínuo até o quarto dia. Somente no sexto dia de germinação houve aumento no teor de galactose nos cotilédones. Houve tendência de aumento nos teores de arabinose, manose e glicose no eixo embrionário, não sendo detectada a presença de xilose no oitavo dia. Nos cotilédones os mesmos açúcares não foram originalmente detectados no tempo zero, mas apresentaram valores mais altos nas amostras do oitavo dia. Os teores de galactose oscilam tanto no eixo embrionário, quanto nos cotilédones durante o período de germinação de sementes de guapuruvu. Os teores de sacarose aumentam e os de rafinose decrescem nos cotilédones e no eixo embrionário. Os teores de estaquiose permanecem aproximadamente estáveis no eixo e nos cotilédones, com decréscimo no eixo, no oitavo dia. A enzima alfa-galactosidase é pré-formada, tendo clara redução na sua atividade específica, no segundo dia, permanecendo constante até o oitavo. A atividade nos cotilédones apresenta aumento no quarto dia, decrescendo posteriormente. A enzima polygalacturonase é tambem pré-formada, com maior atividade inicial no eixo. A atividade nos cotilédones aumenta até o sexto dia, alcançando maiores valores que o do eixo embrionário e, em seguida, decresce para valores menores do que aqueles.

Sincronización de estros en cabras usando dosis reducidas de prostaglenadinas F2 Alfa en aplicaciones intra-vaginales.

Tesis (Maestría en Ciencias Especialidad en Producción Animal) UANL

Inducción al estro en cabras en anestro estacional usando dosis reducidas de MPA y norgestoment en combinación con estradiol y PGF2 (alfa)

Tesis (Maestría en Ciencias en Producción Animal) UANL

Producción de alfa-amiloga por una cepanativa de bacillus y su aplicación al tratamiento del almidón residual en granos de malta agotados

Tesis (Maestría en Ciencas con Especialidad en Microbiología Industrial) UANL

Determinación de la actividad alfa debida al radón-222 y a sus descendientes, existente en el agua potable de la ciudad de Monterrey, Nuevo León, y su área metropolitana

Tesis (Maestría en Ciencias, con especialidad en Ingeniería Nuclear) U.A.N.L.