995 resultados para INSETOS AQUÁTICOS
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
In specialized literature, reports on anatomy of miners in host plants are few in number. These agents trigger excavations, or paths, by consumption of plant inner tissues by larvae of several insects. The aim of this work was to investigate leaf miner occurrence in Commelina diffusa (a cosmopolitan plant) and Floscopa glabrata (an amphibious plant) using anatomical techniques. The place where the plants were collected is subjected to seasonal floods, consequently both the species were exposed to the same weather conditions and seasonal floods. This study showed that members of Agromyzidae and Chironomidae families, which are Diptera endophytophagous larvae types, were responsible for the tunnels. Moreover, in Commelina diffusa Agromyzidae larvae were found, while in Floscopa glabrata three Chironomidae cephalic exuviae were found. The miners, as can be seen from anatomical studies, used only mesophyll parenchyma tissues for feeding, causing the formation of linear mines. In addition, in both the species, the epidermis and the medium-sized vascular units were kept intact, showing no structural modification, such as neoformation of tissues.
Resumo:
Phytoplankton may function as a "sensor" of changes in aquatic environment and responds rapidly to such changes. In freshwaters, coexistence of species that have similar ecological requirements and show the same environmental requirements frequently occurs; such species groups are named functional groups. The use of phytoplankton functional groups to evaluate these changes has proven to be very useful and effective. Thus, the aim of this study was to evaluate the occurrence of functional groups of phytoplankton in two reservoirs (Billings and Guarapiranga) that supply water to millions of people in São Paulo city Metropolitan Area, southeastern Brazil. Surface water samples were collected monthly and physical, chemical and biological (quantitative and qualitative analyses of the phytoplankton) were performed. The highest biovolume (mm³.L-1) of the descriptor species and functional groups were represented respectively by Anabaena circinalis Rabenh. (H1), Microcystis aeruginosa (Kützing) Kützing (L M/M) and Mougeotia sp. (T) in the Guarapiranga reservoir and Cylindrospermopsis raciborskii (Wolosz.) Seen. and Subba Raju (S N), Microcystis aeruginosa and M. panniformis Komárek et al. (L M/M), Planktothrix agardhii (Gom.) Anagn. and Komárek and P. cf. clathrata (Skuja) Anagn. and Komárek (S1) in the Billings reservoir. The environmental factors that most influenced the phytoplankton dynamics were water temperature, euphotic zone, turbidity, conductivity, pH, dissolved oxygen, nitrate and total phosphorous.
Resumo:
Piperaceae species have been placed among the basal angiosperm and are adapted to a variety of habitats including moist forests, secondary vegetation and dry high lands. The major anatomical/morphology features are of small trees, vines, and shrubs for Piper species, while the epiphytic and succulent characteristics are predominant forms among Peperomia species. Their secondary chemistry can be mostly represented by amides, phenylpropanoids/lignoids, and chromenes in addition to a phletoria of biosynthetically mixed-origin secondary compounds. Although several amides and lignans are known as insecticides, several phytophagous insects, among which some considered pests of economic importance, have been observed feeding vigorously on Piperaceae species. Herein we describe the feeding preferences of fourteen phytophagous species of Coleoptera, Lepidoptera and Hemiptera over approximately fifty Piperaceae species observed in São Paulo, SP, Brazil, in a long-term basis.
Resumo:
Secondary forests and exotic tree plantations are expanding across tropical landscapes. However, our current understanding of the value of these human-dominated forest landscapes for invertebrate biodiversity conservation is still very poor. In this paper, we use the leaf-litter ant fauna to assess invertebrate diversity in one commercially managed Eucalyptus plantation (four years old), two abandoned plantations of different regeneration ages (16 and 31 years), and one neighboring secondary Atlantic Forest in Southeastern Brazil. There was a clear gradient in species richness from the secondary forest to the managed Eucalyptus plantation; richness and diversity peaked in secondary forest and in the older regenerating Eucalyptus plantation. Significantly more species were recorded in secondary forest samples than in Eucalyptus plantations, but Eucalyptus plantations had a similar level of richness. Furthermore, a non-metric multidimensional scaling analysis revealed clear differences in species composition between the younger managed Eucalyptus plantation (understory absent) and habitats with sub-developed or developed understory. Eucalyptus plantations were characterized by an assemblage of widespread, generalist species very different from those known to occur in core forest habitats of southeastern Brazil. Our results indicate that while older regenerating Eucalyptus plantations can provide habitat to facilitate the persistence of generalist ant species, it is unlikely to conserve most of the primary forest species, such as specialized predators, Dacetini predators, and nomadic species.
Resumo:
A detecção do sexo de mosquitos da família Culicidae é importante em estudos faunísticos e epidemiológicos, pois somente as fêmeas possuem competência vetora para patógenos. O dimorfismo sexual de genitália e de apêndices cefálicos é, em geral, facilmente visível em culicídeos. As asas também podem ser dimórficas e assim poderiam complementar o procedimento de sexagem. No entanto, tal distinção não é facilmente notável à observação direta. Visando descrever formalmente o dimorfismo sexual alar em Aedes scapularis, um culicídeo vetorialmente competente para arbovírus e filárias, asas de machos e fêmeas foram comparadas usando-se métodos de morfometria geométrica e análise estatística multivariada. Nestas análises, populações dos municípios São Paulo e Pariquera-Açu (Estado de São Paulo) foram amostradas. A forma das asas mostrou evidente dimorfismo sexual, o que permitiu um índice de acurácia de 100% em testes-cegos de reclassificação, independentemente da origem geográfica. Já o tamanho alar foi sexualmente dimórfico apenas na população de São Paulo. Aparentemente, a forma alar é evolutivamente mais estável que o tamanho, interpretação que está de acordo com a teoria de Dujardin (2008b), de que a forma alar de insetos seria composta por caracteres genéticos quantitativos e pouco influenciada por fatores não-genéticos, enquanto que o tamanho alar seria predominantemente determinado por plasticidade decorrente de influências ambientais.
Resumo:
The identification of the sandfly fauna and investigation of some ecological aspects of its populations in areas frequented by tourists of the PEI, an Atlantic forest reserve with many caves, were the objective of this study. Captures were undertaken monthly from January 2001 to December 2002, with automatic light traps installed in 13 ecotopes, including caves, forests, domiciliary and peridomiciliary environments, and by aspiration in armadillo burrows. Additionally, although not at regular intervals, Shannon traps were installed in forests and anthropic environments, aspirations were made on cave walls, among roots and fallen leaves, and some insects were captured while biting researchers. A total of 891 sandflies belonging to 21 species were captured. Six hundred specimens representing 19 species were captured with light traps, 215 in anthropic (2.24 insects/trap) and 385 in extra-domiciliary (1.46 insects/trap) environments. Brumptomyia troglodytes was the most abundant species (the Standardised Index of Species Abundance = 0.705). Pintomyia monticola predominated in the Shannon traps and showed anthropophilic and diurnal activity. Psathyromyia pascalei predominated in the aspirations; the largest number being in armadillo burrows. Eleven species were captured in caves; although some might be troglophiles, the majority used these ecotopes as resting places. Nyssomyia intermedia, Nyssomyia neivai and Migonemyia migonei, implicated in the transmission of cutaneous leishmaniasis in the Southeastern Brazilian region, were all found, though in such low densities as to suggest minimal risk of the disease in the PEI.
Resumo:
The blood feeding of a population of Cx. nigripalpus from Parque Ecológico do Tietê (PET) was investigated using an indirect ELISA protocol. Mosquitoes were captured outside houses. Five hundred sixteen engorged females collected in a reforested area and 25 in an open area were tested. Rodents and dogs were the most common blood sources, accounting for approximately 65.3% of blood meals. Human blood was detected in 10.9%, dog blood in 26.1%, chicken blood in 2.4%, and rodent blood in 39.2% of the 541 insects tested. ELISA failed in identifying the blood sources of 233 engorged females, indicating that the mosquitoes may have fed on a host which was not tested. One hundred six individuals were positive for more than one host. The unweighted human blood index was 0.14 and the rodent/human, human/chicken, and dog/rodent feeding index values were 2.70, 1.51, and 1.33, respectively. Furthermore, rodents are defensive hosts for this haematophagous insect which looks for another host to complete blood-feeding. Considering that rodents are potential reservoirs for Mucambo virus and Saint Louis encephalitis virus and that Cx. nigripalpus feed on the blood of those mammals, we hypothesize that mosquito population in PET could participate in the transmission cycle of those arboviruses. Additionally, this species might be involved in the transmission of Dirofilaria immitis to dogs at this area.
Resumo:
OBJETIVO: Comparar a diversidade da fauna de culicídeos em bromélias de solo segundo ambientes urbano, periurbano e mata primitiva. MÉTODOS: O estudo foi realizado no município de Ilhabela, litoral norte do estado de São Paulo, em tanques de bromélias de ambientes urbano, periurbano e mata. Realizaram-se coletas de imaturos quinzenalmente, de março de 1998 a julho de 1999. A presença e freqüência de espécies nos diferentes ambientes foram comparadas com base em estimativas da diversidade para medir a riqueza, dominância e análise de variância (ANOVA). RESULTADOS: Coletaram-se 31.134 formas imaturas de mosquitos nas bromélias, distribuídas em sete gêneros e 37 espécies. O ambiente urbano registrou maior abundância, 14.575 indivíduos, seguido do periurbano com 10.987, e a mata, com o menor número de exemplares, 5.572. Foram coletadas 30 espécies no habitat urbano, 32 no periurbano e 33 na mata. As espécies dominantes foram Culex (Microculex) pleuristriatus nos ambientes urbano e periurbano, e Culex ocellatus na mata. De acordo com teste ANOVA a freqüência de mosquitos em bromélias não foi diferente entre os ambientes pesquisados (F=0,5564; p=0,5769). A diversidade de espécies na mata foi maior, e semelhante entre periurbano e urbano. CONCLUSÕES: A composição específica de culicídeos em bromélias de solo mostrou-se diversificada, sendo maior naquelas de ambiente de mata. As espécies dominantes foram Cx. (Mcx.) pleuristriatus e Cx. ocellatus.
Resumo:
Primeiro relato da ocorrência de larvas de Anopheles (Kerteszia) cruzii, mosquito essencialmente silvestre, em bromélias de solo em área urbana do município de Ilhabela, litoral norte do estado de São Paulo. De março de 1998 a julho de 1999 foram capturadas 312 formas imaturas de An. cruzii, sendo 8,6% em bromélias do ambiente urbano, 40,1% em bromélias do periurbano e 51,3% na mata. O número médio de bromélias com An. cruzii foi de 4,0% dentre o total de pesquisadas, com valores próximos de positividade para ambiente periurbano e mata. A presença de An. cruzii no ambiente urbano provavelmente é resultante da sua ocorrência prévia na mata, aliada à elevada presença desse criadouro na área urbana, de fonte alimentar e abrigos disponíveis. Alerta-se para a possibilidade de transferência de infecções entre esses ambientes
Resumo:
Nucleotide sequences of the internal transcribed spacer 2 (ITS2) rDNA and partial sequences of the cytochrome coxidase subunit I (COI) mtDNA and white gene nDNA were obtained from specimens of Anopheles nuneztovari A collected in Macapá (state of Amapá), Óbidos, Prainha and Almeirim (state of Pará), Itacoatiara and Parintins (state of Amazonas), Brazil, and compared with previously published sequences of A. nuneztovari s.l. Results of the Bayesian phylogenetic analyses performed using either COI or combined ITS2, COI and white gene sequences suggest that An. nuneztovari B/C is distinct from specimens obtained in the Amazonas/Solimões River basin. Anopheles goeldii, currently in synonymy with An. nuneztovari, was described from individuals collected in Belterra (= Fordlândia) in the Tapajós River, state of Pará, Southern Amazonas River. Morphological comparisons of the characteristics of the male genitalia indicated that An. nuneztovari A and An. goeldii are similar but distinct from An. nuneztovariB/C by the apex of the aedeagus. In considering the results of the phylogenetic analyses and morphological comparisons, An. goeldii is resurrected from synonymy with An. nuneztovari. Additionally, Anopheles dunhamiis reported for the first time in Parintins. This species can be distinguished from An. goeldiiby characters of the male genitalia and molecular data
Resumo:
Relata-se a primeira ocorrência de Panstrongylus guentheri Berg no Brasil. Essa espécie, até então, havia sido observada somente na Argentina, Paraguai, Bolívia e Uruguai. Desta feita, amplia-se a distribuição geográfica desse Triatominae por meio de dois exemplares capturados nos municípios de Bodoquena e Itaporã, ambos no Mato Grosso do Sul. Esses exemplares estavam em ambiente intradomiciliar
Resumo:
Anopheles (Nyssorhynchus) benarrochi s.l., Anopheles (Nyssorhynchus) oswaldoi s.l., and Anopheles (Nyssorhynchus) konderi s.l. collected in Acrelândia, state of Acre, Brazil, were identified based on morphological characters of the male genitalia, fourth-instar larvae, and pupae. Morphological variation was observed in the male genitalia of these species in comparison with specimens from other localities in Brazil. DNA sequence from the nuclear ribosomal second internal transcribed spacer of individuals identified as An. benarrochi s.l. by using male genitalia characteristics showed that the various morphological forms are conspecific but are distinct from An. benarrochi B from Colombia. Anopheles konderi s.l. and An. oswaldoi s.l. both misidentified as An. oswaldoi s.s. (Peryassú) throughout Brazil, may actually comprise at least two undescribed species. Diagnostic morphological characteristics of the male genitalia are provided to distinguish Anopheles benarrochi s.l., Anopheles oswaldoi s.l., and Anopheles konderi s.l. from morphologically similar species. Incrimination of An. oswaldoi s.s. in malaria transmission in Brazil needs further investigation because other undescribed species from Acre may have been confounded with this taxon