1000 resultados para Frutas


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The creation of the Brazilian Program for the Modernization of the Horticulture by the Secretariat of Agriculture and Supplying of the State of São Paulo at CEAGESP, determined the standardization of fruit and vegetables in the follow aspects: degree of coloration, format, calibers, defects and packing. Therefore, the main goal of this research is to correlate the classification given by the Brazilian Program with the one used by the wholesalers at CEAGESP, verifying if the established norms are being fulfilled for cultivar Carmen and Debora (SAKATA SEED). The results showed, that for cultivar Carmem, for the averages of the observed values it does not move away from the norms created by the Program for sizes small and medium. However, for the case of cultivar Debora, the results showed differences between the adopted classifications. The tomatoes were devaluated, because had been commercialized below of the standardization indicated for the Brazilian Program.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

On the last years, in Brazil, sorting and classifying fruits and vegetables using packing lines have increased. This work aimed at characterizing the cleaning process for fresh market tomatoes at two packing lines, one imported and one national located at Campinas, São Paulo State. Characterization included data, number, types and brushes velocity, water use, fruit standing time and cleaning efficiency. Standing time was measured correlating to fruit diameter (CEAGESP). For measuring cleaning efficiency an equipment was developed that was mainly composed of a ring involved with white cloth. Samples were taken before and after the cleaning step and evaluated using a colorimeter HUNTER Lab. The results showed a strong difference between the two equipments. The imported equipment showed lower number on brushes and rotation than national one, however a higher water consumption. For imported equipments this relation was not found. Both packing lines showed the same cleaning efficiency. Cleaning efficiency is related to be an interaction among the studies parameters, and it could be necessary a better management than the one used on both equipments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fresh-cut sliced fruits and vegetables are ready to eat immediately and their sensorial characteristics should be similar to fresh product. Although most of the studies in this area are focused on vegetables, there is a great market potential for fresh-cut sliced fruits, mainly for those which exhibit some commercialization or preparation difficulties such as pineapple. The objective of this work was to evaluate the effect of 1% and 3% concentrations of calcium salts (chloride, sulphate and lactate) on pH, total soluble solids and firmness values of minimally processed pineapple slices. Two types of indenters and three firmness indexes were investigated aiming to identify the best index. Results showed that calcium sulphate 3% kept average firmness index up to 44.45% higher than the index value of the control. Even though both indenters exhibited similar variability the cylindrical one was able to point out more differences between control and treatments than the cylindrical borer indenter.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neste artigo, investiga-se a adoção de canais alternativos para a comercialização de produtos agrícolas como forma de atenuar o poder, cada vez maior, exercido pelas grandes redes varejistas. O artigo investiga a decisão - e os efeitos daí decorrentes - de uma determinada empresa sediada no interior paulista, agrícola Pedra Branca, quanto à operacionalização verticalizada de uma butique de frutas, legumes e verduras (FLVs). Consciente dos novos padrões demandados pelo consumidor, a estratégia da empresa alvo do estudo foi combinar a oferta regular de produtos frescos, de qualidade intrínseca padronizada e preços atrativos, a um serviço diferenciado, baseado em um alto valor na experiência de compra. Esta estratégia fundamenta-se no anseio dos consumidores de, mais do que simplesmente adquirir produtos, experimentar sensações, as quais vividas em momentos de lazer exerceriam um grande poder de diferenciação. Realizou-se um estudo de caso baseado em entrevistas em profundidade semiestruturadas com diretores e gerentes da empresa. Como resultado, as evidências empíricas sugerem: 1) a verticalização (integração vertical) da atividade de comercialização como uma alternativa para a apropriação de valor da produção ao longo do canal de distribuição; e 2) o desafio da gestão do suprimento como requisito-chave para a adequada gestão do valor de uma marca. Considera-se oportuno lembrar, porém, que, em decorrência das limitações próprias da metodologia de estudos de caso, estas tais evidências devem ser entendidas como proposição a ser testada em trabalhos quantitativos futuros, ou mesmo melhor embasada via condução de estudos multicaso.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objetivou-se avaliar os fatores demográficos, sócio-econômicos e de estilo de vida associados à qualidade da dieta de adultos residentes na Região Metropolitana de São Paulo, Brasil. Estudo transversal, por meio de inquérito domiciliar, de base populacional, foi realizado no Distrito do Butantã e nos municípios de Itapecerica da Serra, Embu e Taboão da Serra. Utilizaram-se dados de um questionário e um recordatório de 24 horas de 1.840 adultos de 20 anos ou mais, de ambos os sexos, incluídos em um inquérito de saúde (ISA-SP). A qualidade da dieta foi avaliada através do índice de qualidade da dieta (IQD) adaptado para a realidade local. Utilizou-se análise de regressão linear para avaliar a associação entre o IQD e as demais variáveis. A maioria da população (75%) apresentou dieta que necessita de melhora. Observaram-se médias baixas para os componentes: frutas, verduras e legumes, leite e derivados. Número de bens de consumo duráveis, escolaridade do chefe da família e ter 60 anos ou mais se associaram ao IQD em homens. Para as mulheres, a faixa etária se associou ao IQD. Em ambos os modelos, o consumo de calorias se manteve como variável de ajuste.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJETIVO: Avaliar a relação entre o consumo de açúcares de adição e a adequação do consumo de nutrientes e grupos alimentares em adolescentes residentes no município de São Paulo. MÉTODOS: Foram avaliados 793 adolescentes, provenientes de um estudo de base populacional, realizado em 2003. O consumo alimentar foi medido pelo recordatório de 24 horas, tendo sido aplicado método de ajuste por meio de subamostra de 195 indivíduos. O consumo de açúcares foi categorizado em adequado ou inadequado, quando ≤10% ou >10% do valor energético total da dieta, respectivamente. A adequação de ingestão de macronutrientes considerou intervalos de distribuição aceitável, e a prevalência de inadequação dos micronutrientes foi calculada pelo método Estimated Average Requirement como ponto de corte. O consumo mediano dos alimentos foi estimado além dos percentis 25 e 75. Foram utilizados testes de Qui-quadrado, Wald e mediana, com nível de significância de 5%. RESULTADOS: Identificou-se maior proporção de adolescentes com consumo adequado de carboidratos entre aqueles com maior ingestão de açúcares de adição. Todos os adolescentes apresentaram ingestão proteica dentro dos valores preconizados e verificou-se associação significativa entre a adequação de lipídeos e o consumo de açúcares de adição somente entre os adolescentes do sexo masculino. Maior porção mediana de leite, carnes, frutas, suco industrializado, refrigerante e achocolatado em pó foi identificada entre os adolescentes com consumo excessivo de açúcares de adição. CONCLUSÃO: O consumo excessivo de açúcares de adição se mostrou relacionado à menor adequação do consumo de nutrientes e à menor ingestão de alimentos de alta densidade nutritiva.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJETIVOS: Verificar a idade de introdução de alimentos complementares nos primeiros dois anos de vida e sua relação com variáveis demográficas e socioeconômicas de crianças matriculadas em pré-escolas particulares do município de São Paulo. MÉTODOS: Estudo transversal com informações demográficas e socioeconômicas de 566 crianças, sendo verificada a idade em meses de introdução dos alimentos complementares. Foi considerada como variável dependente a idade em meses da introdução dos alimentos complementares e, como variáveis independentes ou explanatórias, a idade e escolaridade maternas, a condição de trabalho materno e a renda familiar. Para análise da relação entre as variáveis, utilizou-se a técnica de regressão múltipla de Cox. RESULTADOS: 50% das crianças eram do sexo masculino e 61% maiores de 4 anos. A maior proporção das mães tinha nível superior de escolaridade e trabalhava fora. A renda familiar mostrou uma população de alto nível socioeconômico. A água e/ou chá, frutas e leite não-materno foram introduzidos antes do sexto mês de vida. A variável 'idade da mãe' mostrou associação com introdução de três grupos de alimentos: cereais, carne e guloseimas. CONCLUSÃO: Alimentos complementares foram introduzidos precocemente nessa população de nível socioeconômico elevado e a única variável que se associou à introdução desses alimentos foi a idade materna.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to validate the intake of carotenoids, fruits and vegetables estimated by the Food Frequency Questionnaire for Adolescents (FFQA) using the method of triads. Blood samples were collected from 80 elementary school adolescents to assess serum levels of β-carotene. Partial correlation coefficients (r) were calculated between an estimated intake of carotenoids, fruits and vegetables and the serum levels of β-carotene. Validity coefficients were calculated using the method of triads. With the exception of carotenoids, partial r from the food frequency questionnaire (FFQ) were greater than those of the 24-hour recall (24hR). The fruit/vegetable group showed the highest partial r for the FFQ (r = 0.235) and the 24hR (r = 0.137). The highest validity coefficient was obtained for the vegetable group, as assessed by the FFQ (r = 0.873). On average, the validity coefficient values for the FFQ were greater than those obtained for the 24hR or the β-carotene serum levels. The FFQA is an accurate tool for estimating the intake of carotenoids, fruits and vegetables in this population group.