Behind Recurrent Thromboembolic Events

We describe the case of a 68-year-old man, who presented with an ischemic stroke due to cardiac embolization related to mitral valve endocarditis. Blood cultures were always negative and post-operative valve histology did not show microorganisms. The patient also presented further recurrent peripheral embolic events. These clinical aspects were the first sign of a pancreas adenocarcinoma, which was only diagnosed in the clinical autopsy. In conclusion, these clinical findings of recurrent thromboembolic events with no microorganisms isolated suggests the diagnostic of a marantic endocarditis.

Cardiac Magnetic Resonance Assessment Of Interstitial Myocardial Fibrosis And Cardiomyocyte Hypertrophy In Hypertensive Mice Treated With Spironolactone.

Nearly 50% of patients with heart failure (HF) have preserved LV ejection fraction, with interstitial fibrosis and cardiomyocyte hypertrophy as early manifestations of pressure overload. However, methods to assess both tissue characteristics dynamically and noninvasively with therapy are lacking. We measured the effects of mineralocorticoid receptor blockade on tissue phenotypes in LV pressure overload using cardiac magnetic resonance (CMR). Mice were randomized to l-nitro-ω-methyl ester (l-NAME, 3 mg/mL in water; n=22), or l-NAME with spironolactone (50 mg/kg/day in subcutaneous pellets; n=21). Myocardial extracellular volume (ECV; marker of diffuse interstitial fibrosis) and the intracellular lifetime of water (τic; marker of cardiomyocyte hypertrophy) were determined by CMR T1 imaging at baseline and after 7 weeks of therapy alongside histological assessments. Administration of l-NAME induced hypertensive heart disease in mice, with increases in mean arterial pressure, LV mass, ECV, and τic compared with placebo-treated controls, while LV ejection fraction was preserved (>50%). In comparison, animals receiving both spironolactone and l-NAME (l-NAME+S) showed less concentric remodeling, and a lower myocardial ECV and τic, indicating decreased interstitial fibrosis and cardiomyocyte hypertrophy (ECV: 0.43 ± 0.09 for l-NAME versus 0.25 ± 0.03 for l-NAME+S, P<0.001; τic: 0.42 ± 0.11 for l-NAME groups versus 0.12 ± 0.05 for l-NAME+S group). Mice treated with a combination of l-NAME and spironolactone were similar to placebo-treated controls at 7 weeks. Spironolactone attenuates interstitial fibrosis and cardiomyocyte hypertrophy in hypertensive heart disease. CMR can phenotype myocardial tissue remodeling in pressure-overload, furthering our understanding of HF progression.

Onset Of Hypertension During Pregnancy Is Associated With Long-term Worse Blood Pressure Control And Adverse Cardiac Remodeling.

Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

T-wave alternans: desempenho clínico, limitações, metodologias de análise

Reconhecer com precisão indivíduos com maior risco imediato de morte súbita cardíaca (MSC) ainda é uma questão em aberto. A natureza fortuita dos eventos cardiovasculares agudos não parece se adequar ao conhecido modelo de indução de taquicardia/fibrilação ventricular por um gatilho em sincronia a um substrato arritmogênico estático. Quanto ao mecanismo da MSC, uma instabilidade elétrica dinâmica explicaria melhor a raridade da associação simultânea de um gatilho certo a um substrato cardíaco apropriado. Diversos estudos tentaram medir essa instabilidade elétrica cardíaca (ou um equivalente válido) em uma sequência de batimentos cardíacos no ECG. Dentre os mecanismos possíveis podemos citar o prolongamento do QT, dispersão do QT, potenciais tardios, alternância de onda T ou T-wave alternans (TWA), e turbulência da frequência cardíaca. Este artigo se atém em particular ao papel da TWA no panorama atual da estratificação de risco cardíaco. Os achados sobre TWA ainda são heterogêneos, variando de um desempenho prognóstico muito bom até um quase nulo, dependendo da população clínica observada e protocolo clínico usado. Para preencher as atuais lacunas no conhecimento sobre TWA, profissionais médicos e pesquisadores devem explorar melhor as características técnicas das diversas tecnologias disponíveis para a avaliação de TWA e atentar ao fato de que os valores de TWA respondem a diversos outros fatores, além de medicamentos. Informações sobre mecanismos celulares e subcelulares da TWA estão fora do escopo deste artigo, mas são referenciados alguns dos principais trabalhos sobre este tópico, com o intuito de auxiliar no entendimento dos conceitos e fatos cobertos neste artigo.

Fatal adenoviral necrotizing bronchiolitis case in a post-cardiac surgery intensive care unit

We report a case of a 67 year-old-male patient admitted to the intensive care unit in the post-coronary bypass surgery period who presented cardiogenic shock, acute renal failure and three episodes of sepsis, the latter with pulmonary distress at the 30th post-operative day. The patient expired within five days in spite of treatment with vancomycin, imipenem, colistimethate and amphotericin B. At autopsy severe adenovirus pneumonia was found. Viral pulmonary infections following cardiovascular surgery are uncommon. We highlight the importance of etiological diagnosis to a correct treatment approach.

Renin angiotensin system and cardiac hypertrophy after sinoaortic denervation in rats

OBJECTIVE: The aim of this study was to evaluate the role of angiotensin I, II and 1-7 on left ventricular hypertrophy of Wistar and spontaneously hypertensive rats submitted to sinoaortic denervation. METHODS: Ten weeks after sinoaortic denervation, hemodynamic and morphofunctional parameters were analyzed, and the left ventricle was dissected for biochemical analyses. RESULTS: Hypertensive groups (controls and denervated) showed an increase on mean blood pressure compared with normotensive ones (controls and denervated). Blood pressure variability was higher in denervated groups than in their respective controls. Left ventricular mass and collagen content were increased in the normotensive denervated and in both spontaneously hypertensive groups compared with Wistar controls. Both hypertensive groups presented a higher concentration of angiotensin II than Wistar controls, whereas angiotensin 1-7 concentration was decreased in the hypertensive denervated group in relation to the Wistar groups. There was no difference in angiotensin I concentration among groups. CONCLUSION: Our results suggest that not only blood pressure variability and reduced baroreflex sensitivity but also elevated levels of angiotensin II and a reduced concentration of angiotensin 1-7 may contribute to the development of left ventricular hypertrophy. These data indicate that baroreflex dysfunction associated with changes in the renin angiotensin system may be predictive factors of left ventricular hypertrophy and cardiac failure.

Sildenafil preserves diastolic relaxation after reduction by L-NAME and increases phosphodiesterase-5 in the intercalated discs of cardiac myocytes and arterioles

OBJECTIVES: We investigated the influence of sildenafil on cardiac contractility and diastolic relaxation and examined the distribution of phosphodiesterase-5 in the hearts of hypertensive rats that were treated with by NG-nitro-L-arginine methyl ester (L-NAME). METHODS: Male Wistar rats were treated with L-NAME and/or sildenafil for eight weeks. The Langendorff method was used to examine the effects of sildenafil on cardiac contractility and diastolic relaxation. The presence and location of phosphodiesterase-5 and phosphodiesterase-3 were assessed by immunohistochemistry, and cGMP plasma levels were measured by ELISA. RESULTS: In isolated hearts, sildenafil prevented the reduction of diastolic relaxation (dP/dt) that was induced by L-NAME. In addition, phosphodiesterase-5 immunoreactivity was localized in the intercalated discs between the myocardial cells. The staining intensity was reduced by L-NAME, and sildenafil treatment abolished this reduction. Consistent with these results, the plasma levels of cGMP were decreased in the L-NAME-treated rats but not in rats that were treated with L-NAME + sildenafil. CONCLUSION: The sildenafil-induced attenuation of the deleterious hemodynamic and cardiac morphological effects of L-NAME in cardiac myocytes is mediated (at least in part) by the inhibition of phosphodiesterase-5.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Cardiac response and anxiety levels in psychopathic murderers

OBJECTIVE: To compare the emotional response and level of anxiety of psychopathic murderers, non-psychopathic murderers, and nonpsychopathic non-criminals. METHOD: 110 male individuals aged over 18 years were divided into three groups: psychopathic murderers (n = 38); non-psychopathic murderers (n = 37) serving sentences for murder convictions in Maximum Security Prisons in the State of Sao Paulo; and non-criminal, non-psychopathic individuals (n = 35) according to the Psychopathy Checklist-Revised. The emotional response of subjects was assessed by heart rate variation and anxiety level (State-Trait Anxiety Inventory) after viewing standardized pictures depicting pleasant, unpleasant and neutral content from the International Affective Picture System. RESULTS: Psychopathic murderers presented lower anxiety levels and smaller heart rate variations when exposed to pleasant and unpleasant stimuli than nonpsychopathic murderers or non-psychopathic non-criminals. The results also demonstrated that the higher the score for factor 1 on the Psychopathy Checklist-Revised, the lower the heart rate variation and anxiety level. CONCLUSION: The results suggest that psychopathic murderers do not present variation in emotional response to different visual stimuli. Although the non-psychopathic murderers had committed the same type of crime as the psychopathic murderers, the former tended to respond with a higher level of anxiety and heart rate variation.

Simvastatin-induced cardiac autonomic control improvement in fructose-fed female rats

OBJECTIVE: Because autonomic dysfunction has been found to lead to cardiometabolic disorders and because studies have reported that simvastatin treatment has neuroprotective effects, the objective of the present study was to investigate the effects of simvastatin treatment on cardiovascular and autonomic changes in fructose-fed female rats. METHODS: Female Wistar rats were divided into three groups: controls (n=8), fructose (n=8), and fructose+ simvastatin (n=8). Fructose overload was induced by supplementing the drinking water with fructose (100 mg/L, 18 wks). Simvastatin treatment (5 mg/kg/day for 2 wks) was performed by gavage. The arterial pressure was recorded using a data acquisition system. Autonomic control was evaluated by pharmacological blockade. RESULTS: Fructose overload induced an increase in the fasting blood glucose and triglyceride levels and insulin resistance. The constant rate of glucose disappearance during the insulin intolerance test was reduced in the fructose group (3.4+ 0.32%/min) relative to that in the control group (4.4+ 0.29%/min). Fructose+simvastatin rats exhibited increased insulin sensitivity (5.4+0.66%/min). The fructose and fructose+simvastatin groups demonstrated an increase in the mean arterial pressure compared with controls rats (fructose: 124+2 mmHg and fructose+simvastatin: 126 + 3 mmHg vs. controls: 112 + 2 mmHg). The sympathetic effect was enhanced in the fructose group (73 + 7 bpm) compared with that in the control (48 + 7 bpm) and fructose+simvastatin groups (31+8 bpm). The vagal effect was increased in fructose+simvastatin animals (84 + 7 bpm) compared with that in control (49 + 9 bpm) and fructose animals (46+5 bpm). CONCLUSION: Simvastatin treatment improved insulin sensitivity and cardiac autonomic control in an experimental model of metabolic syndrome in female rats. These effects were independent of the improvements in the classical plasma lipid profile and of reductions in arterial pressure. These results support the hypothesis that statins reduce the cardiometabolic risk in females with metabolic syndrome.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Study of the cardiac left atrioventricular valvar complex in water buffaloes (Bubalus bubalis) of the Jafarabadi breed

Atrioventricular valve complex of 30 Jafarabadi water buffaloes, adult males were studied in this research with no heart diseases. The animals were obtained from a slaughterhouse in Brazilian State of Parana. The hearts were opened at the third portion affording access to the valve complex. The complexes had its area, number and type of tendinous cords submitted to analysis. The results showed that the complex is composed by two cusps and four accessory cusps, two or three papillary muscles in which 10-25 tendinous cords fix on the cusps that face the ventricle wall. The total area of the complex was on average 38.56cm², with a minimum of 24.96cm² and a maximum of 55.54cm². Statistically, no relation between the number of cords and the cusps' area where they are inserted or with the number of papillary muscle where they originated from was observed.