971 resultados para secondary structure detection
Resumo:
The interactions of lanthanium trichloride and terbium trichloride with bovine blood Cu (Zn)-superoxide dismutase [Cu(Zn)-SOD] in the aqueous solution of hexamethylenetetrarnine buffer (pH = 6.3) have been studied by using fluorescece, CD and ESR spectra. The results indicated that rare earth ions were coordinated to the carboxyl groups of acidic amino acid residues which were far from active center of the Cu(Zn)-SOD molecule and only lightly disturbed the secondary structure of the enzyme protien, and made the coordination structure of enzyme-bound CU2+ come from the rhombchedron to the axial shape at 77 K and the activity of Cu(Zn)-SOD enzyme was not nearly changed at room temperature.
Resumo:
Mitochondrial genome sequence and structure analysis has become a powerful tool for studying molecular evolution and phylogenetic relationships. To understand the systematic status of Trichiurus japonicus in suborder Scombroidei, we determined the complete mitochondrial genome (mitogenome) sequence using the long-polymerase chain reaction (long-PCR) and shotgun sequencing method. The entire mitogenome is 16,796 by in length and has three unusual features, including (1) the absence of tRNA(Pro) gene, (2) the possibly nonfunctional light-strand replication origin (O-L) showing a shorter loop in secondary structure and no conserved motif (5'-GCCGG-3'), (3) two sets of the tandem repeats at the 5' and 3' ends of the control region. The three features seem common for Trichiurus mitogenomes, as we have confirmed them in other three T. japonicus individuals and in T nanhaiensis. Phylogenetic analysis does not support the monophyly of Trichiuridae, which is against the morphological result. T. japonicus is most closely related to those species of family Scombridae; they in turn have a sister relationship with Perciformes members including suborders Acanthuroidei, Caproidei, Notothenioidei, Zoarcoidei, Trachinoidei, and some species of Labroidei, based on the current dataset of complete mitogenome. T japonicus together with T. brevis, T lepturus and Aphanopus carbo form a clade distinct from Lepidopus caudatus in terms of the complete Cyt b sequences. T. japonicus mitogenome, as the first discovered complete mitogenome of Trichiuridae, should provide important information on both genomics and phylogenetics of Trichiuridae. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
A fragment of TNFalpha cDNA sequence from red seabream was cloned by homology cloning approach with two degenerated primers which were designed based on the conserved regions of other animals' TNF sequences. The sequence was elongated by 3' and 5' RACE to get the full length CDS sequence. This sequence contained 1264 nucleotides that included a 5' UTR of 85 bp, a 3' UTR of 514 bp and an open reading frame (ORF) of 666 bp which could encode 222 amino acids propeptide. In 3' UTR, there were several mRNA instability motifs and three endotoxin-responsive sequences, but the sequence lacked the polyadenylation signal. The deduced peptide had a clear transmembrane domain, a TNFalpha family signature and a TNF2 family profile. The cell attachment sequence and the glycosaminoglycan attachment sites were also found in the sequence. The red seabream TNF sequence shared relatively high similarity with both mammalian TNFalpha and TNFbeta by multiple sequence alignments. Phylogenetic analysis showed that the piscine TNFalpha were located independently in a different branch compared with mammalian TNFalpha and TNFbeta. Based on the primary and secondary structure analysis and gene expression study, we could concluded that the red seabream TNF should be a TNFalpha, not TNFbeta. RT-PCR was used to study TNFa transcript expression. 24 h after the red seabream was challenged by Vibrio anguillarum, the RS TNFalpha transcript expression were detected in blood, brain, gill, heart, head kidney, kidney, Ever, muscle and spleen. Results showed that TNFalpha mRNA was constitutively expressed in parts of the tissues both in stimulated and unstimulated fish and the expression could be enhanced after the pathogen infection.
Resumo:
Thymidylate synthase (TS), an essential enzyme for catalyzing the biosynthesis of thymidylate, is a critical therapeutic target in cancer therapy. Recent studies have shown that TS functions as an RNA-binding protein by interacting with two different sequences on its own mRNA, thus, repressing translational efficiency. In this study, peptides binding TS RNA with high affinity were isolated using mRNA display from a large peptide library (>10(13) different sequences). The randomized library was subjected up to twelve rounds of in vitro selection and amplification. Comparing the amino acid composition of the selected peptides (12th round, R12) with those from the initial random library (round zero, R0), the basic and aromatic residues in the selected peptides were enriched significantly, suggesting that these peptide regions might be important in the peptide-TS mRNA interaction. Categorizing the amino acids at each random position based on their physicochemical properties and comparing the distributions with those of the initial random pool, an obvious basic charge characteristic was found at positions 1, 12, 17 and 18, suggesting that basic side chains participate in RNA binding. Secondary structure prediction showed that the selected peptides of R12 pool represented a helical propensity compared with R0 pool, and the regions were rich in basic residues. The electrophoretic gel mobility shift and in vitro translation assays showed that the peptides selected using mRNA display could bind TS RNA specifically and inhibit the translation of TS mRNA. Our results suggested that the identified peptides could be used as new TS inhibitors and developed to a novel class of anticancer agents.
Resumo:
This thesis describes a system that synthesizes regularity exposing attributes from large protein databases. After processing primary and secondary structure data, this system discovers an amino acid representation that captures what are thought to be the three most important amino acid characteristics (size, charge, and hydrophobicity) for tertiary structure prediction. A neural network trained using this 16 bit representation achieves a performance accuracy on the secondary structure prediction problem that is comparable to the one achieved by a neural network trained using the standard 24 bit amino acid representation. In addition, the thesis describes bounds on secondary structure prediction accuracy, derived using an optimal learning algorithm and the probably approximately correct (PAC) model.
Análise do grau de conservação de resíduos em proteínas com estrutura 3D resolvida utilizando o SMS.
Resumo:
HSSP e entropia relativa. Módulos do SMS para análise de conservação. Discussão e trabalhos futuros.
Resumo:
King, R. D. and Ouali, M. (2004) Poly-transformation. In proceedings of 5th International Conference on Intelligent Data Engineering and Automated Learning (IDEAL 2004). Springer LNCS 3177 p99-107
Resumo:
Ferr?, S. and King, R. D. (2004) A dichotomic search algorithm for mining and learning in domain-specific logics. Fundamenta Informaticae. IOS Press. To appear
Resumo:
Gatherer, D., and McEwan, N.R. (2003). Analysis of sequence periodicity in E. coli proteins: empirical investigation of the 'duplication and divergence' theory of protein evolution. Journal of Molecular Evolution 57, 149-158. RAE2008
Resumo:
The beta-adrenergic receptor kinase (beta ARK) phosphorylates its membrane-associated receptor substrates, such as the beta-adrenergic receptor, triggering events leading to receptor desensitization. beta ARK activity is markedly stimulated by the isoprenylated beta gamma subunit complex of heterotrimeric guanine nucleotide-binding proteins (G beta gamma), which translocates the kinase to the plasma membrane and thereby targets it to its receptor substrate. The amino-terminal two-thirds of beta ARK1 composes the receptor recognition and catalytic domains, while the carboxyl third contains the G beta gamma binding sequences, the targeting domain. We prepared this domain as a recombinant His6 fusion protein from Escherichia coli and found that it had both independent secondary structure and functional activity. We demonstrated the inhibitory properties of this domain against G beta gamma activation of type II adenylyl cyclase both in a reconstituted system utilizing Sf9 insect cell membranes and in a permeabilized 293 human embryonic kidney cell system. Gi alpha-mediated inhibition of adenylyl cyclase was not affected. These data suggest that this His6 fusion protein derived from the carboxyl terminus of beta ARK1 provides a specific probe for defining G beta gamma-mediated processes and for studying the structural features of a G beta gamma-binding domain.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P
Resumo:
Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.
Resumo:
WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.
Resumo:
Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.